Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25301  (registered. 2007)
Contig Information
Length 2741 bp
Clones 109 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 24
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 11
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 5
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 11
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0760600 [Oryza sativa (japonica cultivar-group)] >gi|57900353|dbj|BAD87343.1| putative aspartate aminotransferase [Oryza sativa Japonica Group] >gi|113533848|dbj|BAF06231.1| Os01g0760600 [Oryza sativa (japonica cultivar-group)] >gi|215737226|dbj|BAG96155.1| unnamed protein product [Oryza sativa Japonica Group]
Score 965
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25301
TTTTTTTTTTCCCAAAACTAGGCATTATACAGCGCTGCAGGATAAATACCTCAGCATTCAAGGGTAAGAAAAGCATCACAACTGCAGCTTATTCGGGATT
CGAAATCACCATAATCTTTAATCCGGTGTGTACAAAACTGTCTCAGACAACAAGTTTAATGAGTCTACAAGGCAAATTCTCGAGTTCAGCCAGTAACACA
CCTCTGGTTGAACCCCTCGGAAACTGCTGTAGAGAATTCAAGATTTTATTGTGCGAGGGGGTTGCAATGTTATCATTCACTTCAGTTTTGTTACTGCGGC
ATGTATGGCATCTGCAAGATGGGGTACAGTTCTGGAGCTCAAACCGGCCATGCTGATCCTCCCATCAGATGTCATGTAAATGTGATATTCTTGCCTCATG
AAGGCTACTTGATCACTGTTGAGCCCAGTGAAAGTAAACATCCCAATCTGCTTAATGATGTGGGACCAATCTCCAGGTGTTTCCCTGATTTTCAGCGCAT
TAAAAAGCTGCTCCCTCATGCTAATTATCCTATCAGCCATGGCCTTCAGCTCCAGAGTCCATTCGTCGAACATAGCACTACAAATTGAGAAAAAATAGTC
AATAAGAACTAAGCACTACCAATTATTAGATTTGTCGATCTGCCAATAAAAATTCATTTCAACACAACTCAGTCTATGATTGAATAGAATACTACCTGTC
CTTAAGTATGGTAGCCACAATAGAAGCACCATGAAGAGGAGGGTTCGAATACATAGGCCTAATTACAAGCTTAAGTTGACTTTCAACCTTAACAGCTATA
TCAGCACTCCCACAAACGATGCTTAAAGCACCAACACGCTCTCCATACAATCCCATGTTCTTGGCATAGCTTTGAGCCATGAGCAATTCACCACCATCAG
CGACGAACATGCGCACTGATTGGGCATCTTTGTCAAGGCTTCCGCTTGCAAATCCTTGGTAAGCACTGTCAAAGAATGGCAGCAATGCTTTTGATCTCAT
CAGCTGCCTGATCTGTTCCCACTGTTCCAAGGTTGGGTCGACACCAGTAGGATTATGGGGCACATGCATGAAGCAGTACAATTGCGCCTGAGGGAGCTGA
ACTGAGGTCTTCTAAGAGTCCTTGGAAATCCAGTCCACGAGTTGCAGGATCATAGTACCGGTAACTCCTAGCAGTCAGGCCAGCTAAAGTGAAGACTTTT
GGGTGATTCCCCCAGGTTGGCTGGGGGATGTAGATAGTGCGTTCATGGTAGTGCCTTGCAAGAAATTCACCTCCCACTCGTAGGGAACCAGTTCCTGATA
AGCACTGCACTGTAGCCACCCTATTTTCCTGAATAGCAGGACTGTCGGCACCGAAGATAAGCTTAGCACTCAACTTGTTGAAATCGGCCAATCCAGTGAT
CGGCAAGTACTCCTTAACACGTGACTCGTTATGGATCAGCATCTGCTCGGCGCGCTTGACCACATTCAGCACGAGGGGCTTCCCTTCCTCGGTCCGGTAG
GCGCCGACGCCGAGGTTGACCTTGACGGGGCTGGGATCCTTGTTGTACGCGACCGTCACCCCGAGGATGGGGTCCTCCGGGCCCTGCGCGATCCCGGCGA
AGACGGAGGGCGACGCCATGGTGGGGAAAGGTTGGAGCGAGTCGGCGGAGGTGGCGGATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGC
GTCGCCGGCACGAAGGCCGTGCGATCCGTCGAGTTATCATGAATCATCGGATCAGCGAGCAGAGCCCGCGTCAGCCTTTTATCTAATAAATGCGCCCCTC
CCAGAAGTCGGGGTTTGTTGCACGTATTAGCTCTAGAATTACTACGGTTATCCGAGTAGCACGTACCATCAAACAAACTATAACTGATTTAATGAGCCAT
TCGCAGTTTCACAGTTCAAATTGGTTCATACTTGCACATGCATGGCTTAATCTTTGAGACAAGCATATGACTACTGGCATCGCATCGGCCATTGAGAGGA
AACGAAGGGAGAGCGGCGGAGGAGGCGAAGGCATCATCCATGGCCGCGGTGGTCCGGAGCGTGTGGCAGGGGATCAGGGAGAAGGGCCTCACCAACTTCC
TCCGCTACGCCCGCGAAGAGGGATACCTAAAATGCCTTGGGGACGGAAACCTATTGCAAACCAAAATTCACAACATTGGTGCAACCCTTGTAGGAGTTGA
CACTTTTGGAAACAAGTACTATGAGAAACTACATGACACTCAGTATGGAAGGCATAGGTGGGTAGAGTATGCGGACAAGGGTCGCTACAATGCATCCCAA
GTGCCTGCTGAATGGCATGGATGGCTGCACCACATTACAGACAGCACTGGGGACAAGCTGCTGGAGGAGAAGACTAAAAAGTTCATTAGGGAGCACAGAC
AGAACTACACCGGACAGGGTGACGACTTGATCTACCACTCCAAGGGGCATGCTCTGAACCCAGGGCAAAGGGACTGGACAAGGTACCAGCCTTGGGAACC
AAAGAAAGAAGAGGCCTCCTGATCTGATCTGAATGGTACCTGATAATCCTTTCTATGTTTCGCATTTGGTTTGGTGTCGCCGATCTAAAACCGCCAGTCA
GCTTGGTTTCGTGGACTGGACCTGAATAATGTACTCTATCTGATACTGAATACCTGCCACTGAACAATTTTAATCTGTGTGTGGATGTGGCAATGGAAAA
ACTGGCGATTGGGTCGTCGGTGTTTGCATTGAAAAAAAAAA
page-top