Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25300  (registered. 2007)
Contig Information
Length 2039 bp
Clones 109 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 13
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|54291859|gb|AAV32227.1| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|57863918|gb|AAS55771.2| putative disulfide-isomerase [Oryza sativa (japonica cultivar-group)] >gi|113578247|dbj|BAF16610.1| Os05g0156300 [Oryza sativa (japonica cultivar-group)] >gi|215678906|dbj|BAG96336.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692773|dbj|BAG88199.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215704383|dbj|BAG93817.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196130|gb|EEC78557.1| hypothetical protein OsI_18529 [Oryza sativa Indica Group]
Score 1423
Evalue 1.83791e-166
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25300
CTTCTGTAACTATAGCTCAAATCCATACTTAACAACAGATCGCTGTATAAGGCTGTCAATAAGAATTTTACCATGAGGGTCAAGCATTAACATGTCTTTA
GCACTTTGAAAGTAAAAATTGCTAAAACTATTTGTCTCCCTCCTTACGGTTAAGGGTAATGACTTCAAACATGGCCAGCTCCTATAGTGTGACGGGCGGT
GTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTCATGCAGGCGAGTTGCAGCCTGCAATCCGAACT
GAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGA
CTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTGGCAACTAAACACGAGGGTTGCGCTCGTTGCGA
GACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCGAGGGCACCCCTCTCTTTCAAGAGGATTCGCGGCA
TGTCAAGCCCTGGTAAGGCCTCGTGCCGAATTCGGCACGAGGGGCGACCCCTCAGATCTACCGCAAAACCCTCCTCCCCGTCCTCCTCCTGCTCGCCGCC
GCGGCGCTCTACCCAGCCGCCGCCGACGGCGACGAGGTGCTCGCCCTCACGGAGTCCACCTTCGAGAAGGAGGTCGGCCAGGATCGTGGCGCGCTCGTCG
AGTTCTACGCTCCCTGGGTGTGGCCACTGCAAGAAGCTTGCTCCAGAATATGAGAAGCTTGCTGCAAGTTTTAAAAAGGCTAAATCAGTCTTGATTGCCA
AGGTTGACTGCGATGAGCACAAGAGTGTGTGCAGCAAGTATGGAGTTTCTGGCTACCCCACAATCCAGTGGTTTCCCAAAGGTTCCTTGGAGCCCAAGAA
GTATGAGGGTCAACGCACTGCTGAAGCCCTTACAGAATATGTTAACTCTGAAGCAGCAACCAATGTGAAGATAGCAGCAGTTCCTTCAAGTGTTGTGGTT
CTGACCGAGGAAACCTTTGACTCAGTTGTCCTTGATGAAACCAAAGATGTCCTTGTTGAGTTCTATGCCCCATGGTGTGGTCACTGCAAGAGTCTTGCTC
CGATATATGAGAAGGTGGCCTCTGTTTTCAAGCAAGATGAGGGTGTCGTGATTGCTAATCTTGATGCTGACAAATACACAAGCTTGGCTGAGAAGTATGG
AGTTTCTGGTTTTCCCACATTGAAGTTCTTCCCGAAGGGTAACAAAGCTGGTGAAGAGTATGAGAGCGGTCGGGAGTTGGATGACTTTGTTAAGTTCATT
AATGAGAAAAGTGGAACTAGCCGTGATTCGAAGGGTCAGCTTACTTCAGAGGCTGGGCTTGTGGCAAGTTTGGATGCTCTTGTCAAGGAATTCCACAGTG
CTGCTGATGACAAGCGGAAGGAAATCCTCTCTAAAATTGAAGAGGAGGCTGCGAAGCTCAGTGGTCCTGCTGTCAAGCACGGAAAGATCTATGTGAATGT
TGCAAAGAAGATATTGCAGAAGGGCTCTGACTATACCAAGAAGGAAACTGAGAGGCTTCATCGCTTGTTGGAGAAGTCGATCAGTCCTTCCAAAGCCGAT
GAATTCGCCATCAAGAAGAACATTCTTTCAGCCTTCTCCTCTTAGTGGTGGTGACCCACGTGCCATAGTCAGTAGTGCAACAGTACCACCTGCCACAAGA
GAGAAGTGAAGAAAGACAAAGAGAGATAGAGATCAGAGAGATGGCAGTGAAAGTTTAGCGGCGATAGATTTATCTTATTTTGGTTCAATGTTGAACAACA
TCTGATATCTGTTTTCTCTGCCGTTTACCTTTATGGTTACAGGGATTTACTTTAGCAGTAAAAGGGTTTACTCAAGAACAAACCAGTACCAACTGGTAAT
GACATTAATAAATTTGCCATTTGTGTTTTAAAAAAAAAA
page-top