Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25299  (registered. 2007)
Contig Information
Length 847 bp
Clones 109 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 10
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 13
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 8
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VHS Shoot with heat shock treatment 7
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216896 [Zea mays] >gi|194696926|gb|ACF82547.1| unknown [Zea mays]
Score 508
Evalue 6.4755e-54
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25299
TGAGCTAGCAAGCGAACTGCAGGTTAGTTGACGCAGAAGCTACAACAGTGTGTCAATTTTAGACACATGAAACAAGCAACAACAAGACGCAAAAGTAAAA
ATCCATAGCAAAGAAAGGGTTATAATAGATGGCAACCACTTGATTCAAAAGAGGGGAAAGGGTCATTTTCTAAACATGCAACACAATATCTCTCAAAATC
TATAAATCCACAAGATCTGACTTAACATCATAAACGGAGTAGTACAGAACAAGTTGCAAGACGCAGGATATCGATAGCTTGGTATTGTTCCATCCTTGAA
CGAGCATGGAATTACAGCCTCCTTCCTCTTCTACCACCCTTCCGGCGGGTGCTGTCAGTGGGGACCGGGGTAACATCCTCAATGCGTCCAATCTTCATGC
CAGAACGTGCAAGAGCTCTAAGCGCAGCTTGAGCACCAGGACCTGGAGTTTTTGTCTTGTTTCCACCAGTAGCACGGAGCTTAATGTGCAGAGCAGTAAT
TCCAAGCTCCTTACATCTTACAGCAACATCCTGAGATGCAAGCATAGCTGCATAAGGGGATGATTCATCACGATCAGCTTTGACCTTCATGCCACCGGTG
ATGCGGACGAGCGTCTCCCTCCCGGACAGATCCGTGACATGGATGAAGGTGTCGTTGAAGGAGGCGAAGATGTGCGCGACGCCGAAGACGTGCTCCCCCT
CGCGGAGCGGCGGGGCCGAGCGTCACGTTCTCCTCCTTGGGCTCGCGGGTCTTCTTCCTCCCTGACATGGCGGCGGCGGCGGCGGCGAGAGGAGGAGGAG
GCTAGGGTTTGGAGTGGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
page-top