Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25297  (registered. 2007)
Contig Information
Length 1742 bp
Clones 108 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 12
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 16
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 9
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 9
Wh_PCDAM Anther at meiosis 8
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-gamma [Oryza sativa Japonica Group]
Score 1524
Evalue 5.99152e-167
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25297
TAACCTGGGCCGAAAAACGTCTTACGGGAGTAGCTGTTAGCCAGACCACGATGGCGACAATGACCGCTGACTCATGATACACTGATAGATTGTGTATCAT
GCTATGAAGGCCATACATGCTATGATCAGAAACAGTTAGCGGCTAGCAATAGCAGCAATATAACGATTCACGGAAGTAGTAGATGGCTCTATCTGCGGAC
ACAAATGTATAAACCTCGCAGAATAACGAGACAGCAGGACCAGATACCCAAAAACTCTTAGCATAGCACAAAATTAACTAGTTCACCAGGTCAAATAGCC
ATTAAGTAACAAGCAAACTATTCCAAAAAAAGACCAACTGTTTCGACACTGAATTTCAAGTCCTAGATAGGTTCTTTGCCACCGCTCACGATCCCAAGCA
CTGCTCCGCTTACTTGAAGCACTTGGCGTCCAGCAAGGCCTGCCCCTCGAACGGCTCAAGGTCCTCGATCATGGCTTCCACGCGCTTCTTCTGGGCCTCG
TCAGAGAGGTCAACCTTGGTCCACTCGTAGAGCTCCATGTCATAGACCTCCTTCATGACGAACTCAGGGATGTCCTGCCCACGGAAGAGCCACAGCCCCT
TGACCTTGAAGGGCGCCTCAGAACCAATCACGAGCATCTTGCCAAAAGCATACTTGCGGCACAGATCCATCCGCTGCAGGAACCCGCCGACCTTGTTCAG
GGTCACGTACGACACGGTGTTCTCTTCCTGGTACTTGTAGTCACAGAACCACAGAGAGTAGCCCTCTGGGTCATACATCTCCCAGAAACCTTTAACAGCA
ACATCATGGAAGTTGCTCTTAGTGTTTGAGTATAGCCTCTTCCAGTCATCAAGTACCATCTTGCTTGGTGGCAGTAGATCAAGGGGATTTTTGGGCTTAG
GCTTTGGTGCCTCTTCCTCTGGTGCCTCAACTACTGCTGGCTTTGGGGCCGCCTTGGGAGCCTCTTTCTTGGCCTCCTTTTGTTTAGCAGGAGCAGCCTT
CTTCTGAACAGGAGGTACAACCTCTGCCTGCTTGAATTCGCCAATGACCTTCTTGAAGTTAGGCTGGTTAACCATGGTCCAGAAGTACCTCTCAACATGA
GGGAACTCAGATGTGAAAGTCTTGGTCAAGATCCGAGCAAAACCATGGTAGAGGTTGCATGTCATGACAATATCAGCCAGAGTGACAGAATGCCCAACAA
GGAATGTGTTTGATGCCAGGTGTGTGTTCAATGCTTCAAGGGCCCTCTTTAATCCAGCAATGCCGAATTCCTCATCCTGGGCATTGAAAGCCCTATAACC
AAGCCTTGGGTACAACCACCTTGCGATATTGGGATCAACCTCTGTGGCAGCAAAGTCCATCCATTGCTCAACACGTGCATATTCAATAAGAGAACCACCC
CAAAGCAGGTTGTCACCCTTTGAGCGAGCAACATAGCGTGCAATAGCATTGCTCTCAAAAACAGCACCATCAGGAGTCTCAAGAACAGGAACCTTCCCAA
GGGGGTTCATCTTGATGAATTCAGGGGTTTTGTTTGATACACCCATCTCGAAGTTCTTGGGGAGCTCAACCTTGACCCCACAGTACTCTGCAGCAATAAG
TGCCTTGAAGGCATTCTTGTTGCCGCTGCCTGAATGCAAAAGCGAGCGCCATGTCGGCAGGAGCTGCAGGCTTCACCCGATTCCAAATCTCAGATAGAGA
GTGCGGATCGAGACGAGATCGCGGCGGAAACCTCAGCGGGCG
page-top