Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25295  (registered. 2007)
Contig Information
Length 847 bp
Clones 107 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 15
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_MS Seed DPA5 of DT3DL CS wheat 26
Wh_OKCS Seed DPA5 32
Wh_PCDAM Anther at meiosis 20
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit salt tolerant protein [Triticum aestivum]
Score 689
Evalue 1.40867e-70
Total Hit Count 479
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25295
ATATTTTCTACAGATCGAATCAGACCAAATCGCACAAATCTAACACCATTCGTACGTATACGTGATCATAAAGCTGCGACTTTATTATCATTATTATTAT
TCCACTACTCACGCGGCCGTTCCCATCGCACACGTACACGGCCGTTACACACGGTCGTTTACGTGAGAGTAAGCTTGGTGCGGGGACACCGCAGAGAACA
GGCAACGACGACAGTATTCATGGACGGACGGACGGACGGACGGACAGACGGAGGGTCGTCCGCGGCGGCCACCCTGGCGACGAGGCAGCTAAAAGCTGCT
AGTTCTTGAGGAGGTAGTCGTCGAGGTCGTGGAAGGTCTTGGCGGCGGTCTCCTTGATGACGTCCGGCTCGGGCACCTCGTCGCTGGCCTTGTCGAAGTC
CATGGTCCAGTTCACCACCGCGCCGGCGCCGTCGGCGCCCTTGTCGGTCACCTGCACCGTCACCCTGAAGTTCTTGTAGAAGCTCACCAGCTCGCCGTCC
ACCACGCTGTACGACACCACCTTCTTCTCGTCGTCCGCCACCTCCACCTTCTCCTTGGCGAACGTCACCATCGGAACCCCCTCGGTGTACTTGATGAGGC
GGACGGTGCCGGCGGACTTGCCGTCGCCCTCCACGGTCTCGATGCTCTTGTACTGCTCGGGGAAGATCTTGGGGAACAGCTCCGTCGACTCGCGCATCGC
CGTCCACAGCTTCTCCGCCGGCGACTTCACCTCCACCACCAGCTCGACCTTGGACGCCATCGATCGACCGGGATGCAAGGTTGTACTGCGGTCAAACCTC
TTGCCAGCTACTTGATCAGTGAAGTGACCCTCGTGNCGAATTCCTGC
page-top