Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25294  (registered. 2007)
Contig Information
Length 1451 bp
Clones 107 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 14
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 9
Wh_SHC Shoot grown with cold treatment 8
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 810
Evalue 5.43973e-130
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25294
CAGGCCCTTAGGCGGTGGACGAGCAGTTGCATGCGGCCCCTACGGGACATGCGGCACACAACGGAGTGACCGGCGAAAGACACAACCGATCAGCCGATAC
ACATTATTATCATTAATAGGAGCTAAAGATTATTGCTGATATATGTTCAGTAGCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGGGAGGA
AAACAGTAGCAGCTGCTCCACCACAAAATTACTAGCATAGTACACACATAATAAACACAGGAGAAAAAAGGAGTCTCTTCATCTTCGCTGTCTTCCTCCG
CACCGAGAGGAGCCACATCAAGATTTTTCTTAGGCGGACTTCACGGTGGCGGCGTTGATGATGTCAATGAACTCAGGCTTCAAAGAAGCTCCACCAACGA
GGAAACCATCAACGTCGGGCTGCCCTGCCAACTCCTTGCAGCTTGCGCCAGTTACAGATCCTCCATAGATGATCCTCGTGGATTCAGCAACCTCGGGGCT
CACATTGGTCTTGAGCCAGTCCCTCAGATTGGCATGGACTTCCTGCGCCTGAGCCGGTGTCGCAACTTTACCGGTGCCAATGGCCCACACTGGTTCGTAA
GCGACAACCACATTGGTCCAGTCCTTGATCTTGCCAGCAATTGCTTTTGTCTGTTCAGCGACAACTGCCATGGTTGATCCAGCTTCTCGCTGCTCGAGAG
TCTCACCAACACATGCAATGACCTTCAAGCCCTGAGCAAGTGCATATGCAACCTTCTCTCCAACAAACTCGCTTGATTCTCCCATCAAGCTCCTCCTTTC
AGAGTGTCCAAGGATGACCCAGGGGAACGCCGAGGTTGACAAGCATCTCAGCACTGACTTCACCGGTGAAAGCACCGCCCTTCTTCACCCAGCAGTTCTG
AGCAGCGACTTGGATCTCTGGGCGCAGCTTACCCTTGACGGTGGGAAGGAAGACATAGGGCGGGCTGACGACAACCTCGACAACATCCGTAGAGGCGATC
TGTCCAGCGTTCAGAGTGTTGACGATACTCTCTACCTGTTCCACAGTTCCATTGCATTTCCAGTTGCCGCCGACGAAGAACTTGCGGCCCATGGCGACGG
AGGAGGGGGGAGATCGGATCGGGTTGGGAACGACGGGCGGACGGGAGAGGGGGAGGTCGAGATTGGATTTGGTGGCGGCAGGGTGTGCCCGTTGTGTCGT
GGGGACGTCTGTGAAGGTGTTGTTGCCTCATGAAGACCTTGGCACCGGCTTACCCCCTCAAGGCGCCTCTTGAAGACGGTAGCGCCGCCACATCTCTTGC
AGCCATGGACGAAGCTGTTTGGTTGGTCTGGAGAGGGCTGATTCCCCATTGCTGAAACATGCGATTTCAAGCATTGATTCGACATGTCAAGTTCCCAGAA
TATAACAAAGACCTGTACATATCTTTTGTAGCCCTTATCCCCATGTATGAC
page-top