Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25274  (registered. 2007)
Contig Information
Length 776 bp
Clones 98 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 9
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 12
Wh_PCDAM Anther at meiosis 11
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195618726|gb|ACG31193.1| hypothetical protein [Zea mays]
Score 383
Evalue 3.63724e-35
Total Hit Count 83
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25274
CAAGTTGCCCGCGATTGATTGACGCCAACGTCAGCCTCCGCCTCCACCTCCCACCTCCACGTCTATTAAACGCAGCCGCCTCCTGCTTCTCGCCTTCCCC
ACCAAATTTCCGCCGAAGCAGAAAAAGCATCGTCTCGTCGAGGAATCAACAGCCATGGGCGGCGGCAACGCGCAGAAGTCCAAGATGGCGAGGGAGAGGA
ACCTCGAGAAGCTGAAGGGCGGCAAGGGGAGCCAGCTCGAGGCCAACAAGAAGGCCATGAACATCCAGTGCAAGATATGCATGCAGACTTTCATCTGCAC
CACCTCTGAAGCAAAGTGCAAGGAGCATGCTGAGGCGAAGCATCCGAAGAGCGACCTCGTCCAGTGCTTCCCCCACCTCAAGCAGTGATATCTGCCCAAT
CAGATGGAGAGAGAGATAAAAGAGAGAGAGAAGCTGTCATAATCCACCTAGTATTATCATGTTCCGCAATGACTGATTGTTGACCTAAGCTTGGGTCTGA
ACTCTGGTGTGCTGCTGTCCCAGCTGCTTTGGTTGTGTGCCCATCTACTATGTAATCGTCCTCTATCAGCCTGTTGTGCTACAATATCTTAGTCCTGTGT
GGATTTGCTCCTCGTGCTTAGTCAGTATGCTGTCACAAAATTTATCTTTTTGATAATGTTTCTCGCTTCCAATGGCACCGATGCTAGCTTGGTCAGAGCA
CGGTTTACAGCCAAGCAGCATCAAACATGAGCAGTCTTTTTTTTTTCGAAAGCAAACACAGATTTCTATTATGATT
page-top