Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25272  (registered. 2007)
Contig Information
Length 1660 bp
Clones 98 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 15
Wh_EM Dormant seed with water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 16
Wh_OKCS Seed DPA5 14
Wh_PCDAM Anther at meiosis 7
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2191
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25272
ATTCGGCACGAGGCGCCCACCGCCGCCGCCTCCTCCTCTCCGCTCCTTCTCCTTCCTTCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATC
GTGGTCATTGGCCATGCTCGACTCTGGCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAG
AAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGAGGGGTATCACCATTGATATTGCCC
TGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGA
CTGTGCTGTGCTCATCATTGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTCCTTGCTTTCACTCTT
GGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGATGCCACCACCCCCAAGTACTCGAAGGCCCGTTATGAGGAAATTGTCAAGGAAGTCTCTTCCT
ACCTGAAGAAGGTCGGATACAACCCTGACAAGGTTCCCTTTGTCCCCATCTCTGGGTTTGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTG
GTACAAGGGCCCTACCCTTCTTGAGGCTCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTTCAGGACGTTTACAAG
ATTGGTGGCATTGGAACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTGAGG
TCAAGTCTGTTGAGATGCACCACGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAACGTCAAGAACGTTGCTGTGAAGGATCTGAAGCG
TGGCTTTGTTGCATCCAACTCCAAGGATGACCCTGCCAAGGAAGCGGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATCGGCAAC
GGCTACGCCCCAGTGTTGGACTGCCACACCTCCCACATTGCTGTCAAGTTCGCCGAGCTGGTGACCAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGG
CGCTGCCCAAGTTCCTGAAGAACGGTGACGCTGGTATCGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTCGCCACCTACCCTCCTCTTGG
CCGCTTCGCTGTGCGTGACATGAGACAAACGGTTGCTGTTGGTGTCATCAAGGGCGTGGAGAAGAAGGACCCCACCGGTGCCAAGGTTACCAAGGCCGCC
ATCAAGAAGAAATGAGTGCTCTGGTGTCTGCCATCGAGTTATCTAGCAGAAGTTTTAGTGTCAAGTCTTTTTTGGAGAATCTTAGTGTATGTTAAGTGTT
CCTGGGCGTTATTGCACTTTGACTCCTGCACCTGTGTGCGAGCTATGATGTGTCGTTTAAATACTCTATTTCGATTCCATTATTGTGCTCTTATCCCATT
TGTGGTTTTGTTTTCCTGTGGTGAATGCTAGTACTAGAACCTGCTTTCCCAAAAAAAAAA
page-top