Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25263  (registered. 2007)
Contig Information
Length 948 bp
Clones 96 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 19
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VHS Shoot with heat shock treatment 54
Wh_VWD Shoot grown with dessication 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Ribulose bisphosphate carboxylase small chain PW9, chloroplastic; Short=RuBisCO small subunit PW9; Flags: Precursor >gi|170771|gb|AAA34302.1| ribulose-1,5-bisphosphate carboxylase/oxygenase
Score 867
Evalue 3.85908e-91
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25263
TTTTTTTTTTAGAAGAAAACAATGCAAGACATAGGCATTTCCGGCTGCAAACAAACCAACCTTTCCATCGATTGATGGCAAGACACTAATGCGTTGATTG
CATATAATATATATGTATATGTATAGCCGGTGCTATAATTCTCATATGCATCCTCCTCGACCTACATTGGTAGGTGCTTACATACATATGCTCATATATT
CACATATATATGAGTAGAACGAGAAGTAAAACTGAGAAAGCAGAGCCGCCGACAAATGTGACTAACATGACATGTATATCGGTTACTTCAACTTGCACTT
TAGGCCTTGCCGGATTCCTCGCAACCTGGTGGCCTGAAGGCAATGAAGCTGACGCATTGCACCTGGCGCATGTTGTCGAAGCCGATGACGCGGACATAGG
CATCAGGGTACTCCTTCTTAACCTCCTCGACCTCGTTGAGCACCTGTGTGGCATCGGTGCAGCCGAACATAGGCAGCTTCCACATTGTCCAGTATCGACC
GTCGTAGTACCCGGGGGAGCTGTTGTGCTCACGGAAGACGAAGCCAACCTTGCTGAACTCGAGGCAGGGTACCCACTTGGAGCGGATCAAGTAGTCGACC
TGCTTTAGGAGGGCCTCCGTAGAGAGGGGTGGCAAGTAAGACAGGGTCTCGAACTTCTTGATGCCCTCAATTGGCCACACCTGCATGCATCTTATCCTTC
CGCCATTGCTGACGCTGCTGAGGCCGGCGCTGCCGGAGCGGCGGCTGACGGGGAGGCCCGCGGTCGACTTGAGCCCCTGGAAGGGCGCGACGGTGGTGGC
GGAGGAAGCCATCATGGCGGGAGCCATGGCGGAGTACGTGAATTGCTAGGTGGGGAGGCGATAGCGGCACGAGGCCTCGTGCCGAATTCGGCACGAGGGT
TGCAACAGCTAAATTAGGCTACAATGGCTCTGAGGCTGTGGGCAAGCT
page-top