Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25256  (registered. 2007)
Contig Information
Length 1306 bp
Clones 94 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 20
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 5
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 18
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37384 [Oryza sativa Indica Group]
Score 1068
Evalue 7.40895e-128
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25256
AGCCTACTTAAAATCTAACGAAGTGAATCCCAGCAAACATAAAAGAGAGAAGCACAAGCAGAGCAATGCATATAGGTAACTAAGTGCATGACATAACGTT
AACATATTCGGATACACACTAACAAACAGCATAATTAATTCTTGTTCAAGGTAATAATAGGACTTGGAAAACTTTAGTGTTCAACACTAAACAAAACTGG
CGACTTGAAGGACGGCACACAGCTTAGTCGTCGAACAGGCTGAATCCCATCTCGCCATCTGATTCCTCCTCGGGCTCGTCCTTCTTCTCCTCCTCCTTAG
GGGCAGCGGCGGCAGCACCACCGGAGGCAGCAGCAGCAGGGGCAGCAACGGCAAACTTGCTCGGGTCCTTGAGGTACTCCTTGATCTTATCGGCATGGTC
ATATGAGTAGTCTGTCTCCAAAGCAACCGCAAGAACATTCTTGTATGCGTTGAGGAACATGTGCGGCGCAGCAGCCATGGTGGGGTATGAGATCGCCAGG
GACAGTGAGGCAACCATGGAAACACCAGAAGCAAACTTGTCCATCAGGTCTTCCTCAGTAAGGTCAAGAACCTCAGGGCTGAAGACAGACCCACTGTCAT
AGACATTGCAGATGACCAGTCCATATGAGAAGGGGCGGATACCAAGCTTGGCAAGCAGGGCAGACTCAGAGGAGCCCACCTTGTCACCCTTCTTGATCAG
CTCCACTGGGATAGTAATTTCCACAGTACCCTTGTTAATCTTGGTGGGAATGTTAAGCACCTGGAAGAAGGACGTCTGGGAGGGATCCAGACCAGTGTTG
CCAGGGGGAACCACCACATCAACAGGTGCAACTAGCCCAACACGAGCAGGAGCGCCAACCTTGTACTTGGCGACCTCCTCGCGAACCTCCTTGAGGTCAC
CCTTGGTGAAGATGAGGCCAACGTTACCGACGAGGAGGTTGCTGAGCTCAAGGAAGTCCTTGTTGCCGGTCTTCTCCGAGTGCACCTTGATGCAGCGGCG
GATGAGGGTGTTCTTGCCCATGAGCACGATGGAGTCGCCGCGGAGACCCTTGCGGATCTCCTGGAGCTGCTTGGAGCCCGACATTGTCGGCGACGGCGAT
GAGCACCTTGGTGTACTCCTCGAGCAGCTGGCAGAGCTTCTGGTCGTACGCGATCTTCTTCTCGGCCTTGGTCCTCTTGATCGCCATCGAAGCAGCTACG
AGATGGACGGAGGCGCTAACGCTAGATTGCTAAGCCTGTGTGGGGGGAGAGAGGCGAGAGGATGAGGACCAGGCTCGGGAGAAGAGCGAGGCGGACGGCT
GCGGCG
page-top