Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25252  (registered. 2007)
Contig Information
Length 1945 bp
Clones 93 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 17
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 10
Wh_KMV Shoot grown with continuous light after cold treatment 10
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 7
Wh_RDr Root of dessiccated seed 12
Wh_SHC Shoot grown with cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 15
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1708
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25252
ACCGCAACTGTTGAACTTCATCCATTTTCATCAGGTTGTCATGAGATAGCGCAAATCGGTCAAATGAGTCGCTATGAAAACAAGACCATGCACGCCTATA
ACTATGGCGAAGAAGGCAACCAGGTGGCTTATGGTCAGTCAACGCCGCCCAGGTACGACCTGTCTGTATTGGGAAATTACTCGGCACTATCGTTCTATCT
TGGCTCCACTGATGCCGTCACGAGACCAGCCGATATAGATGAGACACGCAAGCTACTTAGCGGATCCAGTGAGTATCATCTGATCGATGTGCCCTTCAAT
CACTATGGCTTCTTCTTTCACGTAAACGTGTCGCGCTTGGCCATCATACCATCCATGTGGGAAATAGAAAACTTGCCTAGCGCGAATTGAGACGACTAGC
TGATGGAATTTTTCGTCACGGACTCATCAAAGCCCAGCTAACTCAGAGAAGGTTTGAACTTGAATAAAGAGGTTGAAAGTTATGAACAGAAACCCTGCCA
ACCCCAAATCTCCCCTCGCCCGTCGCAGCTCTCGAATCCCCCCCGAGCATCGACCATGTCGGCCTACTGCGGAAAGTACAAGGATGAGCTCATCAAGAAC
GCTGCCTACATCGGCACCCCTGGCAAGGGTATCCTCGCTGCTGATGAGTCCACCGGCACCATCGGCAAGCGCTTTGCCAGCATCAATGTTGAGAACGTTG
AGGACAACCGTCGTGCCCTCCGTGAGCTCCTCTTCTGCACCCCTGGTGCCCTCCAGTACCTCAGCGGCGTGATCCTGTTTGAGGAGACCCTGTACCAGAG
CACCAAGGGTGGCAAGCCCTTCGTCGACATCCTCAAGGCGGGCAATGTCCTCCCTGGCATCAAGGTGGACAAGGGTACCATTGAGCTTGCTGGAACCAAC
GGTGAGACCACCACCCAGGGCTTTGATGACCTTGGCAAGCGCTGCGCCAAGTACTATGAGGCTGGTGCCCGCTTCGCCAAGTGGCGTGCAGTCCTCAAGA
TCGGCGCCACCGAGCCATCGCAGCTCTCCATCGACCAGAACGCTCAGGGTCTGGCTCGCTATGCCATCATCTGCCAGGAGAATGGTCTGGTGCCCATTGT
GGAGCCTGAGATCCTTGTTGATGGACCTCATGACATTGACCGCTGTGCTTACGTCACCGAGATCGTCCTTGCTGCCTGCTATAAGGCCCTCAACGACCAG
CATGTCCTCCTCGAGGGCACTCTCCTGAAGCCCAACATGGTCACCCCTGGTTCTGACTCCAAGAAGGTGGCCCCTGAGGTGATTGCTGAGTACACCGTCC
GCACCCTCCAGAGGACCGTCCCTGCTGCCGTCCCCGCCATTGTCTTCCTCTCTGGTGGACAGAGCGAGGAGGAGGCGACCCTGAACCTGAACGCCATGAA
CAAGCTCCAGACCAAGAAGCCCTGGAACCTGTCCTTCTCCTTCGGGCGTGCCCTCCAGCAGAGCACCCTCAAGGCCTGGTCCGGCAAGACGGAGAACGAG
GAGAAGGCCAGGGCGGCGTTCCTGGTGAGGTGCAAGGCCAACTCCGAGGCCACCCTCGGCACCTACAAGGGCGACGCCACCCTCGCTGAGGGCGCCTCCG
AGAGCCTCCACGTCAAGGACTACAAGTACTGATTGATCTGCCTTCGGTGCTGTGGCCCGTTTGGGCGTCCCGCTTACCAGTATCATTGTCATTGTTTGGT
TTCCTGAGTCCTGATATATCCTCGGATATCGAACATCGTTTTTAATAATATGGAACTTGTGTTTTCATAATACCGTAGTAGTTTCTTTTTGGAGTTGAAG
TACCCTGAAAATCGGGTGCTGCGTATCGTAAATTGGAGCAGGTTTTTGTTCCATGGTCCTGTAATTTACCTGCTCATACAATGTTAAAACCTGTCATATT
CTGAGTACACATGTGTTCCGTCACTTTTTTCTTGCAAAAAAAAAA
page-top