Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25244  (registered. 2007)
Contig Information
Length 1205 bp
Clones 89 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 12
Wh_DPA20 Seed DPA20 11
Wh_EM Dormant seed with water absorption 11
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small Ras-related GTP-binding protein [Triticum aestivum] >gi|19919694|gb|AAM08320.1|AF488730_1 small Ran-related GTP-binding protein [Triticum aestivum]
Score 1053
Evalue 1.51604e-112
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25244
TGAGTGGAGCGACTATATATTGCTGGCTAGTTTCTTGGGAGCATAATATATGTGGCTAGTGATCGCAAAAGCCAACTGAGCAATGAATCAATACAGAGGA
ATTGATGAGTACGATAGCTAAATAGTAATGGTGCCCCTCCTCCTCCTCCCCTAGGGTTTTGCTGCCCCCCTCCACACCCGTGGCCGCCGCCGCCGTCGCC
GCCCGCGTCCCCCCATGGCGCTGCCGAACCAGAACACCGTCGATTACCCCAGCTTCAAGCTCGTCATCGTCGGCGATGGCGGGACTGGCAAAACCACTTT
TGTGAAGAGGCATCTCACTGGAGAGTTTGAGAAGAAATACGAGCCCACCATTGGTGTTGAAGTTCACCCATTGGATTTCACCACTAACTGCGGAAAGATC
CGTTTCTACTGCTGGGACACTGCTGGGCAAGAGAAGTTTGGTGGCCTTAGAGATGGATACTATATCCATGGTCAGTGTGCGATTATCATGTTTGATGTCA
CTTCAAGGCTGACCTACAAGAATGTTCCTACGTGGCACAGGGACCTGTGCAGGGTTTGTGAGAACATCCCCATTGTCCTGTGCGGCAACAAGGTTGATGT
GAAGAACAGGCAGGTTAAGGCCAAGCAGGTGACATTCCACAGGAAGAAGAACCTGCAGTACTATGAGATCTCTGCCAAGAGCAACTACAACTTTGAGAAG
CCCTTCCTTTACCTTGCAAGGAAGCTGGCTGGTGATCCCAACATCCACTTCGTTGAAGCAGTGGCCCTTAAGCCCCCGGAAGTGACCTTCGACCTGGCCA
TGCAGCAACAGCACGAGGCTGAGCTTGCGGCTGCAGCGGCACAGCCACTGCCCGACGACGATGACGATCTGATCGAGTAGAGAGAGGATGATGAGTCTGT
CTGTCTTATCAATCAATACTTTGAGAGCCAGAGACTGTGCGAGTCGGTTTTAGGTTGAAGGCTTGATTTGGAGTAGTCAAGCCGGATGTTTTTCCTGTCT
GCCTTGCCCTTGTCTGGTGGGCTGCAAACTGTTTGTGTGACATTGATCTACATGATGTTGCTTGCCATGGATTTGTTGTTGGCCACCTTGATGGTTCATC
AGTATTATTATGCCTGTTGGCTCAAATGTGTGGATCATATATTTATCTTGAGCATCTGTGTGCTTGCTATGCGTTTTGGGCTAAATAGGTTCGCTGCTGG
ACATT
page-top