Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25242  (registered. 2007)
Contig Information
Length 2420 bp
Clones 88 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 5
Wh_EMC Dormant seed with cold treatment after water absorption 10
Wh_EMI Dormant seed with water absorption after breaking 7
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 8
Wh_PCDAM Anther at meiosis 15
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 7
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0115900 [Oryza sativa (japonica cultivar-group)] >gi|41052596|dbj|BAD07938.1| putative dnaK-type molecular chaperone BiP [Oryza sativa Japonica Group] >gi|41052822|dbj|BAD07713.1| putative dnaK-type molecular chaperone BiP [Oryza sativa Japonica Group] >gi|113535206|dbj|BAF07589.1| Os02g0115900 [Oryza sativa (japonica cultivar-group)] >gi|125537801|gb|EAY84196.1| hypothetical protein OsI_05577 [Oryza sativa Indica Group] >gi|125580560|gb|EAZ21491.1| hypothetical protein OsJ_004974 [Oryza sativa (japonica cultivar-group)] >gi|169244453|gb|ACA50500.1| dnak-type molecular chaperone Bip [Oryza sativa Japonica Group]
Score 2739
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25242
GTGCGCATGTCTCCCTGTAATTAGCTTCATCACTCCATCCATAGTGGAGGGATCGAGACAAGGCCGAGAGGAGGAGGAAGAAGGCTCCGGGAAGCTCGAG
AAGAGGCGAGGAGGAGAGGAGAGGGATCGCGTTGCGCGTCGTCGTGGCGATGGATCGGGTCCGCGGCTCCGCGCTGCTGCTCGGCGTCCTGCTCGCAGGA
TCACTGTTTGCACTTTGTGCTGCAAAGGAGGAGGCCAAGAAGCTCGGTACCGTGATCGGTATCGATCTCGGTACCACCTACTCATGTGTTGGTGTGTACA
AGAACGGTCATGTCGAGATTATCGCCAATGACCAGGGTAACCGTATCACGCCCTCATGGGTTGGGTTCACCGATGGGGAGAGGCTCATCGGTGAGGCTGC
CAAGAATCAGGCGGCTGTCAACCCTGAGAGGACCGTCTTTGACGTCAAGCGTCTCATTGGGAGAAAGTTTGAGGACAAGGAGGTGCAGAGGGACATGAAA
CTTGTCCCCTACAAGATTGTGAACAAGGAGGGGAAGCCTTACATTCAGGTCAAGATCAAGGATGGAGAGACCAAGGTCTTCAGCCCTGAGGAGATCAGTG
CTATGATTCTTGGAAAGATGAAGGAGACTGCTGAGGCATACCTTGGCAAGAAAATCAATGACGCCGTCGTCACTGTTCCTGCGTACTTCAATGACGCGCA
GAGGCAGGCGACCAAGGATGCTGGTGTGATTGCTGGCCTCAATGTGGCTAGGATCATCAATGAGCCCACTGCTGCTGCTATTGCCTATGGTTTGGACAAG
AGGGGCGGCGAGAAGAACATCCTGGTGTTTGACCTGGGTGGTGGTACTTTTGATGTCAGTATCTTGACCATTGACAATGGCGTCTTTGAGGTGTTGGCCA
CCAACGGTGACACCCATCTTGGAGGTGAGGACTTTGACCACAGAATCATGGACTACTTCATCAAGTTGATCAAGAAGAAGCATGGCAAGGACATCAGCAA
GGACAACCGTGCTCTTGGAAAGCTGAGGAGGGAAGCTGAGCGTGCCAAGAGAGCCCTCAGCAACCAGCACCAAGTCCGCGTTGAGATCGAGTCCCTCTTT
GACGGGACTGATTTCTCGGAGCCACTGACCCGTGCCAGGTTCGAGGAGCTGAACAACGATCTCTTCCGCAAGACCATGGGACCAGTGAAGAAGGCCATGG
ATGACGCTGGCCTCGAGAAGACCCAGATCCACGAGATTGTTCTTGTTGGTGGCAGCACCAGGATTCCCAAGGTCCAGCAGCTCCTCAGGGACTACTTTGA
CGGCAAGGAGCCAAACAAGGGTGTGAACCCTGATGAGGCTGTTGCCTTCGGAGCTGCAGTGCAGGGAAGCATCTTGAGCGGCGAGGGTGGTGACGAGACC
AAGGATATCCTCCTCCTCGATGTGGCGCCCCTGACCCTCGGTATCGAGACTGTTGGAGGAGTCATGACCAAGCTGATCCCCAGGAACACCGTCATCCCCA
CCAAGAAGTCGCAGGTTTTCACCACCTACCAGGACCAGCAGACCACCGTCTCCATCCAGGTCTTTGAGGGTGAGCGCAGCATGACCAAGGACTGCCGTCT
TCTCGGCAAGTTCGACCTTTCTGGCATTCCCCCAGCTCCCAGGGGCACTCCTCAGATCGAAGTCACCTTCGAGGTTGACGCCAACGGTATCCTGAACGTG
AAGGCGGAGGACAAGGGCACAGGCAAGTCGGAGAAGATCACCATCACGAACGAGAAAGGGCGCCTGAGCCAGGAGGAGATCGACCGGATGGTCAAGGAGG
CGGAGGAGTTTGCCGAGGAGGACAAGAAGGTGAAGGAGCGCATCGATGCCCGGAACCAGCTGGAGACGTATGTCTACAACATGAAGAACACCGTCGGCGA
CAAGGACAAGCTGGCGGACAAGCTGGAGAGCGAGGAGAAGGAGAAGGTGGAGGAGGCCCTCAAGGAGGCGCTCGAGTGGCTGGACGAGAACCAGACGGCC
GAGAAGGAGGACTACGAGGAGAAGCTCAAGGAGGTGGAGGCCGTGTGCAACCCCATCGTGTCGGCCGTGTACCAGAGGTCCGGCGGCGCGCCCGGGGGCG
AGGGCGCCGACGGCGGCGTCGACGACGAGGACCATGACGAGCTGTAGATGGTTTTAAGGGAACCAATTTTTGTAATGGGGTTAGTAGGGTGAGAGAGGAG
ACATGGATAATTGGTACCGCTGCTGCTTACTTTGGGTCTGCGGTTGTTGGAGGTGGTTGAGACTGCTGTTATTAGTCTGTTGTCCGAGCTGTAGAGAACT
CTTTGCTGCTGCTGTTACTTCCTTCTGATGTTTTTTCGTTTTGTTATTATATAGCCGGATGGATTCGCATCGGAATTTAACGCGAAGAAAAGATATGCAG
TTTTATCTATAAAAAAAAAA
page-top