Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25225  (registered. 2007)
Contig Information
Length 900 bp
Clones 83 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 11
Wh_VABA Shoot with ABA treatment 15
Wh_VHS Shoot with heat shock treatment 23
Wh_VWD Shoot grown with dessication 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 787
Evalue 6.71886e-82
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25225
TTTTTTTTTTAAGGGTAAAAAAAGGGCAAACTTAGATAAACCATATTAGAGTAGTTACATGATGATCTGTTGGTGGATGATAATGTCTGTTTTTACCAAC
AAACTAACATACAAACTCTTCCCCATATATCTGATGTCACGGTCACTGAAATGGTATAACAAACTGCTGGACGCCATGTACAACGACAAAAGAAAACTGG
AACCGATGAACTGAACGCATGGTGAAGCTGGTTTAATTATTGTAGACAAGAGTAGTCGACATGGTTGCAACAAAAAAGGAACGATAATCGAGCAAGGAGC
ACTAGTGGGCGTCCTCCTCCTCGCAGTGCTTGGTGTACTTGGCCGAGTCCAGCAGGCCCTCCAGCTCCGCCGGGCTGCTCGGCTTCACCTTGATCATCCA
CCCCTCCTCGTACGGGCTCGAGTTGATAAGGCCGGGGGTCTCGGACAGCTTTGAGTTGACCTCGACGACCTCGCCGGAGATGGGCGAGTTGACGTCGCTG
GTGGCCTTCACACTCTCCACGTTGCCGAAGGCTCCGCCCTGGCTCACCTTCGTGCCGGCCTCCGGCAGCTCCACGAACACCACCTCCCCGAGATGGCCCT
GGGCGTGGTCACTGATGCCAATCGTGGCCACGGAGCCGTCGTTCTTGACCCACTCGTGGGAGGAAGTGTACTTCAAGCCATCAATAACAGTGGAGAAGTA
TCTGGAGATCGAATAGGCCGGGGCAGCAGCCCTGGCGCCGCTGCTTGAAATCTTGAGGGCATTGGCAGCTGAGCTCGCCCACAGCCTCAGAGCCATTGTA
GCCTAATTTAGGTGTTGCAACCTGAAGCAACAAAGTGAATGTGTGTTCTCTGCTCTCCCTTGTAGGGGATGGTGGCTCGGTGGTAGTAGTGAAAGAGGCC
page-top