Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25222  (registered. 2007)
Contig Information
Length 1028 bp
Clones 82 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 12
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 12
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100193240 [Zea mays] >gi|194690550|gb|ACF79359.1| unknown [Zea mays] >gi|194692752|gb|ACF80460.1| unknown [Zea mays] >gi|194704172|gb|ACF86170.1| unknown [Zea mays] >gi|219886997|gb|ACL53873.1| unknown [Zea mays] >gi|219887209|gb|ACL53979.1| unknown [Zea mays]
Score 903
Evalue 2.94144e-95
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25222
TTTTTTTTTTAGATCAAACCAAGACATATTATGACAGAACACATCGACATTCAACATATCCAAATATGTCTGAACAGGAATAGGTTTCACAAAGACAAGC
ATCAGGCACGTTCTTGCCACTACATCGAAATGTTCATTCCATAAAACTTAACGCATAGCTAAAACAGTTCTAGATATCTTGTAAAACACATTCACTTCAA
AATCTCCAGCCAAAAGCGAGACCCTCAGATGCACATCCATCTTAACGGTTAGCCTTGGCAACACGCTCAATCTCGTCCTTCTTCTTGATGGCATAGCTGT
TGGATGAGCCCTTGGCAGCATTGATCAGCTCATCAGCAAGGCACTCAGCAATGGTCTTGACGTTCCTGAAGGCGCTCTCCCTGGCACCAGTGGTCAGAAG
GTAGATAGCCTGGTTCACCCTCCTCAGGGGGGAGATATCCACAGCCTGCCTCCTCACAACACCAGCAGACCCAATACGGGTAGCATCCTCACGTGGACCA
CTGTTGATGATGGCATCAACGATGATCTGGATGGGGTTGGCGTCGGTGAGGAGGTGGATGATCTCCATGGTGTGCTTGATGATGCGGACGGCCATGATCT
TCTTTCCGTTGTTGCGCCCGTGCATCATGAGGGAGTTGGTGAGGCGCTCGATGATGGGGCACTGCGCCTTGCGGAAGCGCTTGGCCGAGTAGCGACCGGC
GGAGTGCGGCAGGAAAGTGTAGTGCTTCATCGACGTCACCGCGAGGTAGTCGTTCAGCGAGATGTCGGTCACCTGAACATCCTCGAAGGTCCAGCGGTTG
AAGAGCTTCACGTCGCCCCCGGGCACCGGCTCCGCGACCGCCATGGCTGAGGGTGTGGTGGGGGGAGGGGAGGTGGCGGCGGCGGTTGCAGGGGAGTTGG
AAAACCTAGCGAGGACGGAGAACAACCCGTACCTGGGCTTTGTGTACACGAGCTTCCAGGAGCGCGCCACGGCCGTCTCCCACGGCAACACCGCGCGGCG
CGCCAGCACGTCGTCGCCGTGCGCCCGG
page-top