Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25215  (registered. 2007)
Contig Information
Length 1374 bp
Clones 80 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 11
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 8
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=14-3-3-like protein A; Short=14-3-3A
Score 931
Evalue 1.29807e-136
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25215
ATACGAAAATACATTTCGAATAAAATTAATTTTGTAGATGCTGATATAATTAATTTTATATCAAAATGATCAAACTTTTGACTTAGAAGAATCCTACAAG
TCAATTATTTGGAGAGGGAAGTAGGACAAGAAAAACTCAGGGGGGTGCTTGACGCCAAGTATGATCAATCATCAACAAGCCATGAAAATTGCTAATACAG
CAATACTAATAATGTGCTGCAATACAGGAAATAGTTTGAAATCTGCTAATGAACTAAGAAGCGACGATGTCCACATGACCGCCCTCATGACTGTAGTCCA
CTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCTACCACATCTTATGATTCACATAGTGCAACTGACCCTAGTACATCTTATGATCCGAATGA
TACAGGTAGCTGCGTAAATGGACTCAGAAATAAACTTGGGCACGCTCAAGGGCCGGCCAATCAGTGCCCCTCTCCCTCTGGCTTTGAGGCGGCTTCCTTG
ATCTCATCACCACCCTCCTCTGCGTTATCAGAGGTCCAGAGAGTCAAGTTGTCACGAAGAAGTTGCATGATCAAGGTGCTGTCCTTGTAGGATTCCTCGC
CGAGGGAGTCCAGCTCAGCAATAGCTTCATCAAATGCCTGCTTGGCAAGGTTGCAAGCACGGTCTGGAGAGTTCAGGATCTCATAGTAGAACACTGAGAA
GTTGAGTGCAAGTCCAAGCCTTATCGGGTGGGTGGTAGGCAAGTCAGCAAGCGCGATGTCCTGGGCTGACTTGTATGCTACAAGAGTGTTCTCAGCTGCT
TCTTTCCTCTCAGCACCCGCCTTGAACTCCGCAAGGTACCTGTGGTAGTCACCCTTCATTTTCAGATAGAACACCTTGGACTCTGCTGCAGTGGCAGAGG
GGACAAGGTGGGAGTCCAGAAGCTTGAGGATGCCATCACAGATCTTGCTGAGCTCGGTTTCAATCCTGGTACGGTACTCCTTGATTGATGCGACATAGGC
CTCGTTCCCACGGGCTCTCCTCCTTCTGCTCAATGGAGGAGATGATCCTCCAGGAAGCCCTCCGGGCACCAATCACATTCTTGTAAGCCACAGAGAGCAG
GTTGCGCTCCTCAACAGTGAGCTCACCTACATCAGCGGTCTTGGCCACCTTCTCCATGAATTCGACCATTTCCTCATAACGCTCAGCCTGCTCGGCGAGC
TTGGCCATGTACACATTCTCCTCACGGGTTGCCTCAGCGGTAGACATTTTCTCTCTTCTTTGTTGCAAACTAGTTCAGTGCCTTTCCTGTCGCGCTTCGC
TGTTCTCACGGGCTTCGGCTGCGGATCTCGGGTGCGCGCTGTGGGTTCGTGGGGGGAGGGGCGGGGGGGGATAG
page-top