Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25207  (registered. 2007)
Contig Information
Length 1465 bp
Clones 79 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 15
Wh_OKCS Seed DPA5 8
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|109940139|sp|P40392|RIC1_ORYSJ RecName: Full=Ras-related protein RIC1 >gi|57899331|dbj|BAD87942.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|57900421|dbj|BAD87657.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|113532867|dbj|BAF05250.1| Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|125526416|gb|EAY74530.1| hypothetical protein OsI_02420 [Oryza sativa Indica Group] >gi|125570818|gb|EAZ12333.1| hypothetical protein OsJ_002158 [Oryza sativa (japonica cultivar-group)] >gi|215769435|dbj|BAH01664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1013
Evalue 8.62952e-108
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25207
ATATTAACAGCTCAGCTAAAACAGGGCCACAGCATCTGCTGCACTGTTGTAGTTAGGGGGCATGACACTTCTTCCAACAGACGGCATGATAGTAGTACAC
TTAATTTACAGGGGAAGAACAACCAACTGAGTTTTGCAAGAACACTACTGTGATCTTGAGTGTTGATCAAGACGAGCAGCATCCGTTTTGCTGGGCAACA
GGCTGACCCCGCATTTGCACGGTGGCAGGCTTGCTGGCATTTCCAGCCGGTTGGCTTGCCATCCTGTTCTTTATCTCTGCAGCCATGGTCATAAATGCCT
TCTCCACATTTGTTGCATCCTTGGCACTGGTTTCCAGGAATGGTATTCCAATCTCATCGGCAAGGGCCTTGCCAGCCTCGTAAGAAACCACTCTGCTCTC
AGCTAGATCGCACTTGTTCCCCACCAAAAGCTTGTTCACATTTTCACTAGCATACCTGTCAATTTCATTAAGCCACTGTTTGACGTTGTTGAAGCTCTCC
TGGTCAGTCACATCATACACAACAATGATGCCGTGGGCACCACGGTAGTAGCTGCTTGTGATGGTCCTAAATCGCTCTTGTCCAGCAGTATCCCAAATTT
GCAGCTTTATCGTCTTTCCATCTTGCTCAACGGTGCGGATTTTGAAGTCAACACCAATAGTACTGATATAGCTCTCCAGATATGAATCATCCGCAAACCT
CAGCAGCAGGCAAGACTTCCCCACGCCCGAGTCCCCAATGAGCAGCAGCTTGAAGAGGTAGTCATATTCGGGATTCATGGCAGCGGACGGCGGCGGCGAG
TTTCTAGGAGACGAGGCGGCAGGCGATTTCCCGGGAGGCGAAGGCGACGACCGAGGGAGAGGAAAGGTGAGAATTGGGATGAACAAGATTAGTTTGAAAG
CGACAGGTTTTAGGCAAGCTGGCTTCCAAGCAGGAGGTCAGCCTGGACACAATGAACCATACAGACAGAGTACATCGACGCAGGTGGTAAACTGCTGAAA
CCAAACACTTCCAGTTTTCACCACATGGATAACAGAGATACAGGCCAATTCATCGTTCGTTCATTAAGCAGCATCATTAACATCACTTTCCGCCAAACAA
GTAGCCCAGGGAGGAGCCACCGCCAGGAGCAGCATGAACCTTGGTTGAAGGACGGTCCGTAAGGAAGTTGCCCGTGTTCTGGCCATCTGCACGGTAGTAG
TTGTTCGCCCGGCTACCTGGAATGCCAGCTGGAATCTGCTTGGCTACATCAGCAGCTGCCGGTGCTGGTTTCTCAGCAGGTGCGGGCTTCGCAGCTGGTG
CTGCAGCGGGCTTTGCAGGCTCACCATCTCCAAACAGGTAACCCAGAGAACTTTGACCACCACCAGCACTCCCGCCACGACTCATCTTGACTTAGATCGG
GCGCCGACGAGGGGACGGGGGGCGAGGGCGAGACAGGAGGAGGCGCTCGAAGTGGCGGCACGAGG
page-top