Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25203  (registered. 2007)
Contig Information
Length 881 bp
Clones 79 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 8
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 13
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit superoxide dismutase4 [Zea mays] >gi|134597|sp|P23345|SODC4_MAIZE RecName: Full=Superoxide dismutase [Cu-Zn] 4A >gi|6018682|emb|CAB57992.1| superoxide dismutase-4AP [Zea mays]
Score 723
Evalue 1.70778e-74
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25203
ATCCATTCATCATCCCATCCCCCAAGCCATAAACCCAAGTCGGACTCGCCTTCCTCCTCCCCCAACTACTCCTCCTCGCCTCCGCGCATCGCACCGCACC
GGGGGTCACCTGAGGTAGATCACATACACAATGGTGAAGGCTGTGGCTGTGCTTACCGGCAGTGAGGGTGTCAAGGGCACCATCTTCTTCACCCAGGAGG
GAGATGGCCCGACCACCGTGACGGGAAGTGTCACTGGACTCAAGGAAGGGCTCCACGGCTTCCATGTGCACGCTCTTGGTGACACCACCAATGGCTGCAT
GTCAACTGGACCACACTTCAACCCCGCTGGTCATGTGCATGGGGCACCCGAAGATGAAATCCGCCATGCTGGTGATCTTGGAAATGTGACAGCTGGAGCG
GATGGTGTTGCTAACATCAATGTTACTGACTGCCATATCCCCCTTACTGGACCAAATTCAATTGTTGGCCGTGCTGTTGTCGTCCATGGTGACGCTGATG
ATCTTGGCAAGGGTGGACATGAGCTGAGCAAGAGCACTGGAAACGCTGGTGCCCGTGTTGCTTGCGGAATCATCGGGCTCCAGGGCTAGATGTCATCTTC
GCCGACCAACGTCGTACAGATCTGGGAACCTTTTCAGAATGCAGATTTGCAATCTCTATTCTAAATAAGCACATGATCTTTGATCACTTGTTAGTGTGCA
CCATTCATGTCAATTCCAATGTGCTACTCTGAACTTTATCACTGTCATTTGGCTATGATTTGCGTGACTGGAACAGTTGTCAAGTGCTTGTGGATCTGCT
GTTGTTCTTTAAGCCGCTACCAGCTCTGGACATATTTACAGAAAACGAGAGAGATTTCAGATTTCATCTTAAAAAAAAAAA
page-top