Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25197  (registered. 2007)
Contig Information
Length 1720 bp
Clones 78 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 10
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 10
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Enolase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1163
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25197
TTTTTTTTTTGAGAATACTGCAACAAGTAGACTAACACAATAACAGTGAAGATGATGCGCCAAAAACTAGTATTACACACCCAAAAGGTTCGGGGCCGAA
TCAGGTACATATCCACAAGGACCAAAATTGGAGCAAGTTTGGGGGTACATATCCGTTCCGTTCACATAAACATGCGCGGCATTATTGCTCAATCCTAAGA
GCTTCAACCAGAGTTCATTCCGGAGGTTAAACACACCCATTTTCACAAAAACTCGCGAAGATACCGTCTAGTAGGGCTCCACCGGTGCGCGGAACTTGAG
GCCAGCATACACTGCAGCGTCGCCCAGCTCCTCCTCGATCCTCAGAAGCTGGTTGTACTTGGCAAGACGCTCTGACCGGCAGGGAGCCCCGGTCTTGATC
TGACCCGTGGACAGACCAACAGCCAAATCAGCAATGAATGTGTCCTCGGTCTCACCACTCCTGTGGCTGGTCATGACACCCCAGCCAGCATGTTTTGACA
TCTTCACGGCCTCGATACTCTCAGTGACGGATCCAATTTGGTTAACCTTCAGCAGAAGAGCATTGCATGACTTCTCCTGGATTGCCTTCGCAACTCTGGT
TGGGTTGGTGACTAGAAGGTCATCACCAACAATCTGAACTTCCACTCCACATTCTTCAGTCATCTTAGCATAGTGCACCCAGTCATCCTGGTCAAATGGG
TCCTCAATCGACACAATGGGGTACTCACTCACAAATGACTTGTATACGTTCTTCAGGCTATCTCCAGATATCTTCTGAGAACCATCATTGTTCTCCTCCT
TGAAGTTGAGGTCATAGGTTTTGTCCTTGTCATTGTAGAACTCTGAAGCAGCAACATCCATTCCAATGACAACCTTGCCGGTGTATCCAGCCTTTTCAAT
TGCAGTCTTCAAGAGCTCAAGGGCCCTCCTTATTCTCCTGAATGTTAGGAGCAAAACCACCTTCATCTCCGACATTGGTGGCATCCTGCCCGTACTTCTT
CTTGATAACAGACTTCAAGTTGTGGTACACTTCAACACCCATCTTCATTGCCTCCTTGAATGAGGCAGCTCCAGTAGGAAGGATCATGAACTCCTGCATA
GCAAGCTTGTTTCCAGCATGGGATCCACCATTAATGACATTGAACGCAGGAACGGGCAAAACCAATTGCTTGTTGCCAGCAAGGTTGGCAATGTGCTGGT
ACAGTGGAATCTTCTTGACACTGGCTCCAGCTTTGCAAACAGCTAGTGATACAGCCAGGATTGCATTAGCACCAAGCTTTTGCTTGCACCAACCCCACTC
ATTCTTGGTTCCATCAAGCTGCTGAACCATAAAGTTGTCGAGCTCAGTTTGAGCGGTAGGGTCCTTGCCGACCAAAGCGGGTGCAATAATGGAGTTCACA
TTGTTAACAGCCTTGGAAACACCCTTGCCCAAGTAGTCAGATCCACCGTCCCTCAGCTCCAAAGCTTCATAGACACCAGTCGATGCACCGCTGGGAACGG
CGGCCCTGGCAAAGGTTCCATCTGAGCAGCACACATCAACCTCGACGGTGGGGTTGCCGCGGCTGTCGAAGATCTGGCGGGCCTTCACGGACTGGATCGT
CGCCGCCATGGCCGGAGCTCTGGTCTCGCGTCGCGTGGCTTGGAGAGGAAGCCGAGATCGAATCGAATGGAGCGGAGAGCGAGAGGGATGGACGGACGGA
GGGGGCGGCCCCTGCTCTCT
page-top