Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25188  (registered. 2007)
Contig Information
Length 1512 bp
Clones 76 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 3
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 14
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 720
Evalue 3.63726e-114
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25188
GGTTACTGGACTTAACCAGCTTGTTCAGCACAGCGTAGATTACCTGTGATCCCAGCATGCAGCGCAATATTGCGCTGGTAGATATTCTAATATGTAGATC
TGCAAAAATTTAGCACTGCATGGTCTAGGGGATTCTAAGTTGCAAATTCATCCGCCGCCATCTAGTTCATCTATTGTTTGCANATTTCCCTGTACCGTGC
CTTGCTCTTGTTCTGTCTGATGCTATGNATGTACAGATGCAGATGTTTCATACAGACTAGCAATCTATTGTATCATCTTGCTTCATCTATTGCTTATACA
TCTGCTAATATATTGTTTGATGTATCAGCTAGGGTGTTCTTAGNTATAATTCCACCTCTGTAAATTTGGTTCATGCATTGTTTTGATGTACTGCATATTT
CTCTGCACAGTGCCTTACTCTTGTTCTGGTATGTTTTGTATCTACAGATGCAGATCTTTGTGAAGACCCTCACCGGCAAGACCATCACCCTCGAGGTTGA
GTCCTCGGACACCATCGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGGCATCCCTCCGGATCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTCGA
GGATGGCCGCACCCTGGCTGACTACAACATCCAGAAGGAATCCACACTCCACCTGGTGCTCAGACTCCGTGGTGGCATGCAGATCTTCGTCAAGACCCTG
ACCGGGCAAGACCATCACCCTGGAGGTTGAGTCCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAG
CGTCTCATTTTTGCTGGCAAGCAGCTCGAGGATGGCCGCACGCTCGCTGACTACAACATCCAGAAGGAATCCACACTCCACCTGGTGCTCAGGCTCCGTG
GTGGCATGCAGATCTTCGTCAAGACCCTGACCGGCAAGACCATCACCCTGGAGGTCGAGTCCTCTGACACCATCGACAACGTCAAGGCCAAGATCCAGGA
CAAGGAGGGCATCCCACCGGACCAGCAGCGTCTCATCTTTGCTGGCAAGCAGCTTGAGGATGGCCGCACTTTGGCGGACTACAACATCCAGAAGGAGTCC
ACACTTCACTTGGTGCTCCGTCTGCGCGGTGGCCAGTAAGCTCCTGGCCATGGATCTGCTTCTGTCTCTGGGTTCACAAGTCTCGTTGTCCTCGGTGTCC
TCCAATGGAGTCTGGTCTGTGTCCGTTGATGCCTGAACTGTCTTTGTTTGTATACCATATACTGTGATGCAGTGTTATCGTTTGTATCTGCAAACTTCTG
CTGGTGTGCGGAAGCTTTGATGAACTTAAGAATAAGTGAGCCCTGGAGTCGGTCCATAATTCTGTTTGTCTTGCCAGTTGTGTTGTACTGTGGTTTCTTG
CTATCTTTCTGATGCATTTGATGGTACATGTTTTCTGGTTGATGTAAAACTTGATTACCTCTGTGCTCAGTCCTTTACGTTGAACTGATTTTGTATTTCT
GTAAAAAAAAAA
page-top