Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25182  (registered. 2007)
Contig Information
Length 1172 bp
Clones 75 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 7
Wh_EM Dormant seed with water absorption 10
Wh_EMC Dormant seed with cold treatment after water absorption 24
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 12
Wh_V483 Shoot grown under cold condition for 3days 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Gamma-2-purothionin >gi|100844|pir||S11530 purothionin gamma - poulard wheat >gi|227203|prf||1616227B purothionin gamma2
Score 266
Evalue 2.63083e-21
Total Hit Count 227
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25182
CGCGCACGAACCCCCTCCGCCGCCGACCTCGCGTCTTCTCCTGCGCATCTCGGAGGTGCTTCCTAGTTTCCACGATGAAGCTGATCGCTGCCTACCTCCT
CGCCTATCTGGGTGGGAACTCTTCCCCAAGTGCCGCTGACGTCAAGAACATCCTGGACTCAGTTGGTGCCGAGGCTGATGAAGAAAAGCTTGAGTTCCTT
CTGGCTGAACTCAAAGGCAAGGACATCACAGAAGTGATTGCATCTGGAAGGGAGAAGTTTGCCGCTGTGCCTTCAGGTGGGGGTGCCATTGCTGTGGGAG
CTCCAGCTGCTGCATCTGGTGGTGCCGCCGCACCTGCTGCTGAGTCAAAGAAGGAGGAGAAGGTTGAAGAGAAGGAAGAATCTGATGAAGACATGGGTTT
CAGTCTGTTCGACTAAGCGCTTCAGTTCCTCCCCCCTACCCTCTGTTTACCCTAGTATCTGTCGTGTGTGGCCTGCCACAACAGCGCCTGCATAATATCT
AGAGACCTAAAGTTCGTGCTATTTTGCTTGGGACAATGTATATGTTTAGTACCTTAGTATGTGAGTGTGTTACTGCTTCCGCAGCGTTGAGAAGTTGATT
GATAATTTGCCCTCGTGCCGAATTCGGCACGAGGCACCGGTAGTAACAAAGCCAGTACGTAGCGCAAGCAGAGTTTAGCTCGCTCCCAGCCCGGCCGCTC
ACCATGTGGACCAAGAAGGTGGCGACGCAGGTGGTTTTGGTCCTGCTTCTCCTCCTCATCGCACAGGAGGCGGCGGTGCCGGGGGCGGAGGCGAAGATCT
GCCGGCAGCGCAGCGCGGGGTTCAAGGGGCCATGCGTGTCGGACAAGAACTGCGCGCAGGTCTGCCTGCAGGAACGCTGGGGCGGCGGCAACTGCGACGG
GCCCCTCCGCCGGTGCAAGTGCATCAGGCAGTGCTGATCATATGTGGAATGCTACGGCTAGCTGGCCCTCGCCGTACGTCAGCTAGCTAGCCCATGGAGC
CATACGTCTGTGTACCTACTTGAATGTGTGTGTGTGTGTGTGTGCCCCCTTATACGTACGTATGTCGTATGTATATCCGTGTCGCCACTAGCCAGCTGCT
GCATCTCGATCGATGCATGCAAGATAATAATATGAATGAATAAAAACGTACGGTTCATGTTCAAAAAAAAAA
page-top