Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25170  (registered. 2007)
Contig Information
Length 1362 bp
Clones 72 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 3
Wh_SHDr Shoot grown with dessication 20
Wh_V4816 Shoot grown under cold condition for 16days 15
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 11
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit papain-like cysteine proteinase [Hordeum vulgare subsp. vulgare]
Score 1574
Evalue 6.97094e-173
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25170
TTTTTTTTTTAAAAACAAAACGATTGTTTATTTATTATAGGCAAGGATGCATGTGTAGCACCCGAACCTTTACATGCATAGCATAGACATGGAGTAGACA
ATTGAATAGCTAGGTACCGTGCAATTATTCATTACATATATATAATATAAGTAGAGATGCACGGAGTCACACAAAGATGATGGAGGTGCACGGCGGCTGG
ATCATCAGATGATAGGGTAAAGCGGGTACTTGGCAATGCCGCACAAGCCCAAGGGTGGCGAGTCCCTAAGGAAATAGACGAAGCCTTTGTCGCCCCACTG
GTCAGTCCACGAGTTCTTGCCAATCCAGTACTTGGTCCCGTCAGGCTTGGTCCCGTACCCGACGATGGCCAGCGCGTGGTTCTGCGTTGTCCCGCACGCC
CCTTTGTTGTACACGCCCGACCTGGAGCAACCGGCGTTGTACACGCCGCGGATGTAGTGCTGGAAGCAGGGGTCACTGTAGTCGAAGGATGCGGCGACGG
GCTGCTGCGCCACGGCCGCCATCAGCGCCGCCTCGTCACCGGGTGGTGAAATCTTCTTGTAGCCTCTGAGCTTCACCGCGACCGGCTTGGCCCTTTGGCA
CGTGCCCACCTTGCCGGTGTAGGGGTAGGCCGCCTCCGTGGTGATGCCACCGTTCTGGATCACCCACTCGAAGGCCTTGTCCATCCAACTGTTGCCGCAG
CCGTTAATCCGACAGTCCACCAGCTGCTGCTCCGACAGCACCGGTGGCGATCCGCCCGTGCTGATCGCATGCGCGCTCTCCATCGTCGCCACCGACGTGA
ACGCCCAGCAAGACGAACAGGATTCCCCTTGATACTTGGCTGCTGTGACGACGCCTTTCTCCCTCCAATCGACGCTCGCAGGCACCACCGCCGTCAGATT
GGTATTGGTATGACGAGGTGGCTCTTCGACGGCGGCGGTGCCCTCGTGGACGGGGCCAGCGCGAGTTGTGATCACCGTCATCTCCTCCGACTCCCATGAC
GACTCGTCGTTGCTGCTGTACATGGCCATGAACTCGTCGTGGGTGAGGTCGGTGAACGGGGTCTCGCCGAGGCTGTAGCTCATCCGGCTGTCCCGATTCG
CCGCCTCGATGAACTCCATGTTGCTCCGGTACACCTCAAACCGGTGCAGCTTCTCCTCCACGGTGGCGTACGACCGACCGTGCGCCGCCATCCACCCATG
GAACCTCCCCAGCATCAGCAGTGCCTCACCATCCAAGCCATGGTCCAGGGTACCTGAAGCTGATGAAGCCATGGAGGGGATGAAGAATGCGGCTGCCACC
AGTAGCGGCAGCAGAGCCAGAGCCATGGATGAGGACGACGAGCGCATGAAAGCCATGTCCGC
page-top