Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25163  (registered. 2007)
Contig Information
Length 1888 bp
Clones 70 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 13
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Adenosylhomocysteinase; Short=AdoHcyase; AltName: Full=S-adenosyl-L-homocysteine hydrolase >gi|170773|gb|AAA34303.1| S-adenosyl-L-homocysteine hydrolase
Score 2420
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25163
CGAGGCCTCGTGCCGCCTCCTCCCATCACTCTTCTTCTTCCTCCTCTGCCAGATCCAATCCACCAACCTTCTCCATGGCGCTCTCCGTGGAGAAGACCTC
GTCGGGCCGGGAGTACAAGGTCAAGGACCTCTCCCAGGCCGACTTCGGCCGCCTCGAGCTCGAGCTCGCCGAGGTCGAGATGCCCGGCCTCATGGCCTGC
CGCACCGAGTTCGGCCCCTCGCAGCCCTTCAAGGGCGCCCGGATCTCCGGCTCCCTCCACATGACCATCCAGACCGCCGTCCTCATCGAGACCCTCACCG
CCCTCGGCGCCGAGGTCCGCTGGTGCTCCTGCAACATCTTCTCCACCCAGGACCACGCCGCCGCCGCCATCGCCCGCGACTCCGCGGCCGTCTTCGCCTG
GAAGGGCGAGACCCTCGAGGAGTACTGGTGGTGCACCGAGCGCTGCCTCGACTGGGGCGTCGGCGGCGGCCCCGACCTCATCGTCGACGACGGCGGTGAC
GCCACGCTGCTCATCCACGAGGGCGTCAAGGCCGAGGAGGAGTTCGAGAAATCCGGCAAGGTTCCCGACCCGGAGTCCACCGACAACCCCGAGTTCAAGA
TCGTCCTCACCATCATCCGCGACGGGCTCAAGACCGACGCCAGCAAGTACCGCAAGATGAAGGAGAGGCTCGTCGGTGTCTCCGAGGAGACCACCACCGG
CGTCAAGAGGCTCTACCAGATGCAGGAGTCCGGCACCCTCCTCTTCCCCGCCATCAACGTCAACGACTCCGTCACCAAGAGCAAGTTTGACAACCTTTAC
GGTTGCCGTCACTCGCTCCCTGATGGTCTTATGAGGGCCACTGATGTTATGATCGCCGGCAAGGTCGCCGTGGTCTGCGGTTACGGTGATGTTGGCAAGG
GCTGTGCCGCCGCACTCAAGCAGGCTGGTGCCCGTGTGATCGTGACAGAGATTGACCCCATCTGTGCCCTTCAGGCCCTGATGGAGGGTATCCAGATCCT
CACCTTGGAGGATGTTGTCTCTGAGGCTGACATCTTTGTGACCACCACCGGAAACAAGGACATCATCATGGTCGACCACATGAGGAAGATGAAGAACAAC
GCCATTGTCTGCAACATTGGTCACTTTGACAATGAGATCGACATGAACGGCCTTGAGACCTACCCTGGTGTCAAGCGCATCACCATCAAGCCCCAGACTG
ACCGTTGGGTCTTCCCCGAGACCAAGACTGGCATCATTGTTCTTGCTGAGGGTCGTCTGATGAACCTTGGATGTGCCACTGGCCACCCCAGCTTTGTCAT
GTCCTGCTCATTCACCAACCAGGTTATTGCTCAGCTTGAGTTGTGGAACGAGAAGGCCAGTGGCAAGTATGAGAAGAAGGTGTACGTTCTCCCCAAGCAC
CTGGACGAGAAGGTCGCGGCCCTCCACTTGGGCAAGCTCGGCGCCAGGCTGACCAAGCTCACCAAGTCCCAGTCTGACTACATTAGCATCCCAATTGAGG
GTCCTTACAAGCCTGCGGCTTACCGGTACTAGTGTGTCCAGCATGACTAGCGGCTGGCCTGAGCCTGAGTCGGAGCAGCGGCACCAACGGGAACTCTATC
AACTATCCTGTTTCCCTTCTATTATCTTACATGCTGTCTCTTAGGCGGAGGATTTGTTATTATGGTTATGTTTTGAGCCCTTGTGAGGGTTGGGAGAGGC
GGCGTTTGCTTTTGCCCAGAAATAATGGCATTATTATTGGTTTAAGTGAGGAGGTGTGCTTTTCCAGATACAGTTTTGTCTCGTTTGTTCTACCATGCCT
GAAATCCTTAGCAAGCTGTAGCTCATATTTTGTGTGGTTCCTTAATGACTATTGCCGTAAATGCTTGTTTGTCACTGAAAAAAAAAAA
page-top