Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25154  (registered. 2007)
Contig Information
Length 1018 bp
Clones 69 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 13
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 8
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit stress responsive protein [Triticum aestivum]
Score 1088
Evalue 1.03378e-116
Total Hit Count 102
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25154
TTTTTTTTTTGAATCAAACTACCGAGTCCGTTGGAAACGTGGGTGTGTGAGTATTTCACATGAACGGTGCATGCGTATTTCACTGTTTATACGTATTTTA
CTTGGTTCAATCAGCTCATAAAGGTCCTTTATTGTTACGTAACTTGTCATTACACATACAAGCACAACACAGCTGGCTCCGCTTATTCTGCGGCGTAGGT
AGCGAGAGACGCATGCATGTTGTTTATCCGGGACAGTCCACATCGTTTCTTCAGTAGTACTAGTAGATACGTACGTACGGCATGGGTAGGTTTGGGCATG
TCGATCTCCACGCGTGCGTGCACCGTGCACGAGCCACGCACGCATGCATGGCACGCGCTGGCTGGCTCGCTCAGTAGTACGGCTGGAGCTTCCAGCGCTG
GTTGTCGCCCTCGCACCACTTCCAGAGCACGACCTCGGTGCCGTCGCGGACGCCGCCGTGGTACTTGTCGCCGTTGAGGGCGTCGAAGTTGAGGTAGATG
TTGTTCACCATGCGCACGCACCTGAACCCGTTGCCCACGTCCCTGCTCTCCGTCCACAGCACCGACTCGTCCAGGTAGTCTGGGTTGTACGGCACCAGAC
GCACAGGGTGGGACTGGCCGAGGGAGTGCTTGATGGCCTGCCCGGTGGCCTTGTTCACCATGGCGAAGGCGGGGTAGCCCTCCTCGTCCTTGATGCTGGT
GCTCCACCTCATGTCCTTGATCCAGTGCTGGTAGTCGTCCTTGGGGTTGGCCGGCGCCAGCACCACCTTGCCGTTGCGGACGGACATGGCGTAGTTGGGG
TTGGCGCGGCAGTAGATCTTCACCGTGGGCTGCGGCGGCATCGGCCTCCCGCCGTAGTTGCCGTCGATGTTCACCTGCGACATGCCGTACGGCACCGGCG
CCGCGTACCCGGGCGTCGCCATCCCGTACCCGCCGTAGGTCTCGCGGTAGTAGTCCATGGCCGGTACCTGCTCGCCAAGGTGTTCCACCCAAACATCAAC
AGCAAATGCTGCCGTGCC
page-top