Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1203  (registered. 2012)
Contig Information
Length 855 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_h Spike at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_V4816 Shoot grown under cold condition for 16days 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_SP 3
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|16905198|gb|AAL31068.1|AC090120_14|AC090120_14 putative c-myc binding protein [Oryza sativa Japonica Group]
Score 260
Evalue 2.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1203
CCGCCGCCTCTCCCCCATCCCCCTCTCCCACCTCCTCCGGCGTCGGCCAGCAAGCAGCCATGGCGAGCCCCGCGCGCATCGACGTGGATAAGCTGAGCGT
GGAGCAGCTCAAGGCGCTCAAGGAGCAGACCGATCTGGAGGTCAATCTCCTCCAGGACAGCCTATCCAAGATCCGCACCGCCGCCACCCGCCTCGAGAAC
GCCACGGCCGCCCTCCACGAGCTCTCCCTCCGCCCCCAAGGGAAGAAGCTGCTCGTGCCGCTCACGGCGTCCCTCTACGTGCCCGGCACGCTCGACGACG
CCGAGAAGGTCCTCGTCGACGTTGGCACCGGCTACTACATTGAGAAAACTATGACTCAAGGAAAAGAATACTGTGAAAGGAAAATTAATTTGCTGAAGTC
CAACTTCGATGAACTACTTGAGATGGCGACCAAAAAGAAGAGCATAGCAGATGAAATGGGCATGTTTCTGCAAGCCAAGCTGAGGCAGGCATCACCGAGC
TCGAGTTCGTGAGAGCGGAATGCGCGCCCTGTCCCTTGCTTTGTTGCCTTGTTGGAGCGCCGGGGTGGTTCGCTCACTCGCAGCCCTCAGGGAACATAGG
AGGTTCTTTAGCTGTTTTGGCCGTGTGTGCAAGGTTCTCTGAGATGATTTACTGAAACAGCCTGCTCCATCGTCAGACTTCATCCTCGAGTAATTTGGAA
TTCGGTATCAAACGTGTGTGTCTTGGATGCACAATCTGCTTTAATGGCTTTGACAATCAATTATGAGTTTGTTGCATTTTCATGTCTGGATGCTTGGTTT
TGTTTTTGCATGCTGTTGTTGCTTTTCCTGGTACTTGTTGAAACCGTCATATATG
page-top