Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25146  (registered. 2007)
Contig Information
Length 811 bp
Clones 68 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 15
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 8
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 7
Wh_VSCB Liquid cultured tissue 26
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0569200 [Oryza sativa (japonica cultivar-group)] >gi|77556849|gb|ABA99645.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649578|dbj|BAF30090.1| Os12g0569200 [Oryza sativa (japonica cultivar-group)]
Score 467
Evalue 7.15672e-45
Total Hit Count 13
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25146
TTTTTTTTTTAATTGTAAATCAGATTTATAAACTAGAAAACACAACACACCAACGACGGATACAGAGCTGACGACATGCAGTTCATTGCACGGCCATGAA
ACATCTCTAGCCACGCATTCACCACCGCAACTACTAATTGAACAGCAAATCCGACACAACGCGACACGACAGTACAATAGCTCCTTGGAGCAGATGATAA
CTAACTAGCAGCTGCAGTACGACTAAGATCACCGAGCAGCAAACTTATTAAACACACCCAGCAGCTGGATCTAGGGGTTGTAGTAGACGATCTTGATCTC
GTCGACGCCGTGGCACTTGCCGCCGGGGACGGAGTGCTCGAAGCAGTGGCCACCGCTGTTGCAGCCGGCGGTGGGGCAGTGGTCTTTCAGGGGGTGGCCG
TGGGGGGTGATGGAGACACGGATGGGCATGTGCGACTGGTCGGTGCTCACCTGGTACCACGCCCCGCCGTCGTACCCGATGTGGAACTCCGTCACCACGG
CGTCCTGCACCTTCACGCGCCCCGTCCACGAGCACACGTCGTACGACACGTGGGTGCCGTGGCGGAGCAGGTGGCCAGGGCTGTAGAGCAGCTTGCTGTT
GGCCAGCGGCTCGATGCCGAGGTAAAGGTCCTTGCCGCACAGGTTCTGCACCGTAACCTTGCGGCTCGGCTTGCAGTTTTGGGGATCCTGACCGGCGGCG
GACATGGCAGTCGCTGCCAGCGCCACGGCGAGGAGGAGAGCCGCCACGGGCTTGGAGAACGCCATTGGCTGTTACTCGCTGGTTAGGAGTGAAGAGGAGT
GACTGATGCCG
page-top