Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25144  (registered. 2007)
Contig Information
Length 1050 bp
Clones 67 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 9
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 5
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 8.37947e-69
Total Hit Count 398
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25144
CCGATTCGGCACGAGGCACAACCAGACGGCAGGTAAGGGAGGAGGAGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCG
TCCTCAAGTGCGGCAAGGGCAAGGTCTGGCTCGACCCCAATGAGGTCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTAAAGGA
TGGTTTCATCATCAGGAAGCCTCAGAAGATCCACTCCAGGTCTCGTGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAG
CGTAGGGGTACCAGGGAGGCTAGGCTCCCCACCAAGATCCTGTGGATGCGGAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGA
AGATCGACAAGCACATGTACCATGACATGTACCTGAAGGTCAAGGGTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGC
TGAGAAGGCAAGAGAGAAGACCCTCTCTGATCAGTTTGAGGCCAAGCGCGCCAAGAGCAAGGCAAGCAGGGAGAGGAAGCATGCCAGGAGGGAGGAGAGA
TTGGCTCAGGGCCCCAGAGATCATGCACCAGCACCAGCGGCTGCAGCTCCAGCTCCAGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGT
CTGACATGAAGCTTTAGCTTTCTGGTATCATGAAGGGTTAGCCTGATTTTGGAGCATCTGAAGTTCAGAACTGTTTTCTGTGCAATATCTGTGTGCCGCG
TATGAGATACCTTAAATATCATATCGTGTTTGTTCTGTTGGATGTTGCTTATGCAGAGTTTCTTTAAACATTTCGGTTCACCGAACCTAGTTTTACATAT
TCTGTGCGTGCAAATTTATGTACCTACTGTGTTTGTGATGGTAATAGTGCCTGGGTGCCTTCAGTCATCAGAACAGGTGATGGATCTTGGGCGCACAAAA
GGTAGATTTACATCACAAAAAGAATATTTGTCATCACCTGAAAAAAAAAA
page-top