Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25126  (registered. 2007)
Contig Information
Length 1120 bp
Clones 64 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 16
Wh_VABA Shoot with ABA treatment 28
Wh_VHS Shoot with heat shock treatment 5
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit thylakoid lumenal 17.4 kDa protein, chloroplast [Arabidopsis thaliana]
Score 445
Evalue 4.34086e-42
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25126
AATGATAAAAGTAATCTTAAAGGCAAGACTCTGTCGGCGGCATTGATGTCAGGCGCAAAGTTTGATGGTGCTGACTTGACAGAAGTTGTCATGTCCAAGG
CCTATGCTGTTGGTGCAAGTTTCAAAGGCACGAACTTCACGAACGCAGTGATAGACCGTGCCAATTTTGGAAAAGCCGACCTCGAAGGTGCAGTCTTCAA
GAACACCGTCCTGTCGGGATCAACCTTCGACGAGGCTAATATGAAGGACGTCGATTTCGAGGACACACTCATAGGCTACATTGACCTTCAGAAGCTTTGC
AGAAACACCTGCATCCCAGCTCCAATCTTGTCCTCGTGCCGATCAAACTCTCCCTCCGACGACATCGATCCCCGTCTCCCGATCTTCTCCTCCTGACTCC
TGCTGTAGCTGCCAGCCATGGCCTCCGAGACTGTTGTCCTCAAGGTGGCAATGTCCTGCGGAGGTTGCTCGGGGGCGGTTAAAAGGGTGCTCACCAAAAT
GGAAGGCGTCGAGAGCTTCGACATAGACATGGAGCAGCAGAAGGTGACCGTGAAGGGCAACGTCAAGCCAGAAGACGTTTTCCAGACGGTCTCCAAGACC
GGGAAGAAGACCGCCTTCTGGGAGGCCGAAGCCACTCCTGTACCGGAGGCTACCCCGGCAGCCGACGCCGTGCCTGCACCTGAGGCAACCCCGGCAGCAG
ACGCCGCGCCTGCACCGGAGGTGACCCCGGCCAACACCGTCGCTTGATGACCACGCACAGATGATGCCGCCGTGACCTTTGAAAACTCCAAGATATTGTT
GTTGAGAGAGTCATGGCGGTTTGCACGATGTTACTTACGAGTTGACTACAACGTAATGGAATAAAACAAAGTGTGTATGATCTAGACAAATGAACACGTC
GACCACATGATTTACAATAGATTTCAGTTCTATTAATGTTCTACAGCTCTTCCGTTGACGAAAGTGTTCAGTACAGCCGTCCATGTTAAATTTACACAAA
AATGAAATTTGTAGCACAAAGATACAATGTTGTATTAAGGCCTGCTTACTGCAAAAAATTGTGGGACCATGTTATGTTTGGCACTTGCTTGAGACTGCTC
GGGTTTGGAGAAAAAAAAAA
page-top