Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25110  (registered. 2007)
Contig Information
Length 1544 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 12
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 16
Wh_V4816 Shoot grown under cold condition for 16days 14
Wh_V483 Shoot grown under cold condition for 3days 5
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Tetraodon nigroviridis]
Score 85
Evalue 3.72959
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25110
TTTTTTTTTTGGACAAAATGTGTCTTTCATGCAAACGAATAAAAGCATGTGTATCTACACGAAAGAACAACTGAGTCATGTGCACAGATGAACATATACC
AACACGCAAATGATAATTACAGAATAGTAGTACTCATCATGGGTGCATGGCAACAACAGAAACTAAAAGGAATGGTGGAATACAAGGAATACAAAAAGAT
GCATCATCACTATCTCGCTAACCGGATACTATGCCACTTATTCTAGAAATAGCACATCGTGGCTCCGGACGGGGTCGATCTCCTCCTTCAGCTGTCATAT
GTGAGTATCACATCAATTGTCAGTCATCGGTGGCTTGCCCTTCGGAGGCGGCTCCGGCTTCGGTTCGGGCTCAGGCTTGGGCTCTGGCTTAGGCATAGGT
TCAGGCTTAGGCTCTGGTTTAGGCAATGGTTTGGGCTTAGGCTCTGGCTTTGGCATCGGCTCAGGCTTGGGCTCTGGCTTCGGTTCTGGCTTCGGCATTG
GCTCGGGCTTGGGCTCGGGCTTTGGTTCCGGCTTTGGCATCGGCTCTGGCTTGGGCTCGGGTTTGGGCTCTGGCTTTGGTTCCGGCTTTGGCATCGGCTC
GGGTTTGGGCTCTGGCTTTGGTTCTGGTTTGGGCATCGGCTCGGGTTTGGGCTCAGGCTTAGGCTCAGGTTTGGGCATTGGGTAAGGCTTGGGCTCAGGC
TTTGGTTCCGGTTTTGGCATCGGCTCGGGCTTGGGCTCGGGCTTGGGTTCCGGTTTTGGCATCGGCTCAGGCTTGGGCTCAGGCTTGGGTTCCGGTTTTG
GCATCGGCTCAGGCTTGGGCTCTGGCTTAGGTTCGGGTTTCGGCATCGGCTTAGGCTCAGGCTTTATCGGCTCGGGTTTGGGCTCTGGCTTTGGTTCTGG
TTTAGGCATCGGCTCGGGCTTGGGCTCTGGCTTCGGTTCGGGTTATGGCATCGGCTTAGGCTCAGGCTTCATCGGCTCGGGTTTGGGCTCGGGCTTTGGT
TCAGGTTTTGGCATAGGCTCGGGCTTGGGCTCTGGCTTTGGTTCCGGTTTGGGCATCGGGCTCTGGCTTGGGCTCAAGCTTAGGCTCAGGTTTGGGCATC
GGGTCAGGCTTGGGCTCAGGCTTTGGTTCGGGCTTTGGCATCGGCTCCGGCTTCGGCTCCGGTTTGGGCTCTGGCTTTGGCATGGGTTCAGGTTTGGGCA
GAGGCTTAGGCTCTGGTTTTGGCATGGGTTCAGGCTTAGGCAGAGGCTTAGGCTCTGGCTTTGGCATGGGTTCAGGCTTAGGCATTGGCTCTGGCTTGGG
TTCCGGCTTGGGCTCCGGGTACGGCATCGGCTTGGGCTCCGGCTCGGGGAGCTTCTCGGCGAGGCCCCGACCAGCGGCGGCGGCCTGGCTGAAACCAGAG
GCCGCGACCAGCCCGACGAGGAGCACGGCAAGGAGGCTGTGCCTCGCCATTGCTGCTCGCTCCTTCCTCTCGCAGCTCTTGCTGCACCTGTGCTTCACCG
CTTCTAAACCTCTCAACTGAGATAAAGTGGATGGGGTGTCGGTG
page-top