Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25108  (registered. 2007)
Contig Information
Length 885 bp
Clones 63 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 7
Wh_RDr Root of dessiccated seed 18
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Nematostella vectensis] >gi|156212056|gb|EDO33133.1| predicted protein [Nematostella vectensis]
Score 103
Evalue 0.0135198
Total Hit Count 22
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25108
ATCGTCGTCATCCGCCAAACCAGATCGGCTGCTTCTTCTTCTTCTTCTTCTTCAACTTCGCAGAATCGTCGGCGGTCGTCTCTTCCTCTAGTTAGATCCT
TCGAGAGCAATGGGAGGAGGCAATGATGGTCATGGGTACCCACCCGGTGGCCAGGGGGGATACCCTCCGGCAGGGTACCCGCCGCAGCAGGGAGGTTACC
CTCCACAGCAAGGAGGTTACCCTCCACAGCAAGGATACCCGCCTGCACCTGGAGCTTACCCACCTGCACCTGGGGCATACCCTCCTGCACCTGGGGCGTA
CCCTCCTGCACCTGGAGCGGGAGGCCCTGACGGGGAGAAGGGGCTCCTCTCCAACATCATGCATGGTGTTGCCGGTGCTCATGGTGGTGGTCATGGCTAC
CCATCTGGTGGCCACGGGTACCCCCCGCAGCAGCATGGATACCCTCAGCAAGGCTACCCTCCTCAGCATGGCTACCCACCGCAGCAGCATGGCTACCCTC
CACAGCAGCATGGCTACCCCCCTGCTGGCTACCCTGGCTCATCTGGTCACAGTGGTAGCCATGGAGGAGGAGGCATGGGCATGGGTGGCATGCTGGCTGG
AGGAGCAGCAGCTGCTGCCGCCGCTTACGGAGCACACAAGCTTTCTCACGGCGGCCACGGTGGAGGTGGACATATGATGGGAGGCATGATGGGCGGCCAC
GGAGGCTACGGCGGCGGGTACGGCCACCACGGCGGCAAGTTCAAGCACGGGAAGCACGGCCACGGCAAGTTCAAGCACGGCAAGCATGGGAAGCACGGCA
TGTTCGGCGGCGGCGGCAAGTTCAAGAAGTGGAAGTAATGCTGCTAGCTGGTAGCTTCACCATGGCTGATGAATCAAAAAAAAAA
page-top