Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25103  (registered. 2007)
Contig Information
Length 1191 bp
Clones 62 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMP Shoot grown under continuous light 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 11
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1158
Evalue 9.96862e-125
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25103
ATCAGATTTGAATGGCACAAGAAATGTACTTCACAGTTCTTTCAATCAAGCAATTTGCTCTTACAGGAATGCTTACAGGATTTCCAGCATATCCGGATCG
CTTATATTTCCACTAGGAAAAAACAAACCTTTTGAAAACAGAAAAAAGAAAAGAACAGATTAAGAACGAAGCGACTTGGCAAGGAGTATAGAGCACCAAG
ATCCTATACCACTAACTACCGGAACCAACAAATCCCCAACCAATCTCGTCTCCGATCGACTCCAGGCTCGTCGAATCCCCACCGCCTCAAGATGCAGATC
TTTGTGAAAACACTGACAGGCAAGACCATCACCCTTGAGGTTGAGTCGTCTGACACCATCGACAATGTCAAGGCCAAGATCCAGGACAAGGAGGGCATTC
CTCCGGACCAGCAGCGTCTCATCTTCGCTGGCAAGCAGCTGGAGGATGGCCGTACCCTCGCTGACTACAACATCCAGAAGGAGTCCACCCTCCACCTTGT
CCTGCGTCTGCGTGGTGGCATGCAGATATTCGTGAAGACCCTCACTGGCAAGACCATCACCCTGGAGGTCGAGAGCTCCGACACCATTGACAACGTCAAG
GCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTTGCTGGCAAGCAGCTGGAGGATGGTCGCACCCTGGCCGACTACAACA
TCCAAAAGGAGTCCACCCTCCACCTGGTGCTGCGTCTGCGTGGTGGCATGCAGATCTTCGTGAAGACCCTCACTGGCAAGACCATTACCCTTGAGGTTGA
GAGCTCTGACACCATTGACAATGTCAAGGCTAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTCGCTGGCAAGCAGCTGGAG
GATGGTCGCACCCTAGCCGACTACAACATCCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGCCTCCGTGGTGGTCAGTAATTGCCCTATCGTTTGACCT
GCTGCTGCTGCTGCTGTACCCTGTGTCGCCTTTGTTCAAGTGATGTCTCGTTTGTGTGAAGTCGTACTGTGTCTGCTGCTTTAATGGACCATCGAGTCCT
GTGGTTTGGTGCAAACAGTTGCAGGTACATCTGTACCGTTAAGTATGAATAAGTCAACTTTGAAGTAATGTGCCTGTGCTCAAAAAAAAAA
page-top