Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25101  (registered. 2007)
Contig Information
Length 2379 bp
Clones 61 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 12
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 8
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 3077
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25101
CCGCCTCCTAACCCTAGCCGCCTCCCGCACGCTTCTCCTCCGCCTCGAGCAGCTCAGGGACGCGCGCAGCCATGGCGACGGAGACCGAGACCTTCGCCTT
CCAGGCCGAGATCAACCAGCTCCTCTCGCTCATCATCAACACCTTCTACTCCAACAAGGAGATCTTCCTCCGCGAGCTCATCTCCAACTCCTCCGATGCC
TTGGACAAGATCAGGTTCGAGAGCCTCACGGACAAGAGCAAGCTCGATGCGCAGCCCGAGCTCTTCATCCACATCATCCCCGACAAGGCGACCAGCACGC
TCACGATCGTCGACAGCGGCATTGGCATGACCAAGTCGGACCTCGTCAACAACCTCGGGACCATCGCCAGGTCGGGGACCAAGGAGTTCATGGAGGCACT
CGCTGCCGGCGCTGACGTGTCCATGATTGGGCAGTTCGGTGTTGGGTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTCGTCGTCACCACCAAGCACAAC
GACGACGAGCAGTACGTGTGGGAGTCTCAGGCCGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGGGGTACCAAGATGGTGC
TCTACCTCAAGGACGACCAGATGGAATACCTTGAGGAGCGCCGCATCAAGGATCTAGTTAAGAAGCACTCTGAGTTTATCAGCTACCCCATCTCCCTGTG
GACCGAGAAGACCACTGAGAAGGAAATTTCTGACGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATGAGGAGAAG
GAAGAGAAGGAAAAGAAGAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAGCCAGAGGAGA
TCAACAAGGAAGAGTATGCTGCTTTCTACAAGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGCCAGCTTGAGTT
CAAGGCTGTCCTGTTTGTGCCCAAGAGGGCCCCCTTTGACCTCTTCGACAACAAGAAGAAGGCCAACAACATCAAGCTGTATGTGCGCCGTGTCTTCATC
ATGGACAACTGTGAGGAGTTGATCCCTGAGTACCTGAGCTTTGTCAAGGGCATTGTTGATTCAGAGGACCTTCCCCTGAACATCTCCCGTGAGACCCTCC
AGCAGAACAAGATCCTCAAGGTCATCAGGAAGAACCTTGTCAAGAAGTGCATTGAGCTCTTCTTTGAGATTGCTGAGAACAAGGAGGACTACAACAAGTT
CTACGAGGCCTTCTCCAAGAACCTCAAGCTTGGCATCCACGAGGACTCCCAGAACAGGACCAAGATTGCTGAGCTTCTGAGGTACCACTCCACCAAGAGT
GGTGATGAGCTGACGAGCCTCAAGGACTATGTGACTAGGATGAAGGAGGGACAGAACGAGATCTACTACATCACCGGTGAGAGCAAGAAGGCTGTGGAGA
ACTCTCCCTTCCTTGAGAAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATTGGTCAGCTCAAGGAGTTTGA
GGGCAAGAAGCTTGTCTCTGCCACCAAGGAGGGTCTGAAGCTCGATGAGAGCGAGGACGAGAAGAAGAAGCAGGAGGAGCTCAAGGAGAAGTTCGAGGGG
CTGTGCAAGGTCATCAAGGAGGTGCTGGGCGACAAGGTGGAGAAGGTCATCGTCTCTGACCGTGTTGTGGACTCCCCTTGCTGTCTGGTGACTGGCGAGT
ATGGGTGGACCGCCAACATGGAGAGGATCATGAAGGCCCAGGCCTTGAGGGACTCGAGCATGGCTGGCTACATGTCAAGCAAGAAGACCATGGAGATCAA
CCCTGAGAACGCCATCATGGACGAGCTCCGCAAGCGCGCCGACGCCGACAAGAACGACAAGTCAGTCAAGGACCTGGTGATGCTGCTCTTCGAGACCTCC
CTGCTCACCTCCGGCTTCAGCCTGGAGGACCCCAACACCTTCGGCACCAGGATCCACCGCATGCTCAAGCTTGGCCTGAGCATTGACGAGGACGATGAGG
CGCCTGAGAACGACACCGACATGCCGCCCCTGGAGGACGACGCTGGTGAGAGCAAGATGGAGGAGGTCGACTAAGCGCCAAGTCTGCCTGTCGTCGGATG
TTCATGCCCTGCACCGCCTAGTTGTTTTTATCTTTAGTGTCGACGTTGGATGGTCGCTGTATCGGTTTTGTCTTTTGGCTGGCCAAACATTAAGCGCGGC
TAGCTGTTTGTGGTACTCGTGGAACAGTTCGTTATTGTTGGTTCTATTATATGTTAGCTATATTTCTATAAAAAAAAAA
page-top