Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25093  (registered. 2007)
Contig Information
Length 2431 bp
Clones 61 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 10
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cell division protease ftsH homolog 2, chloroplastic; Short=OsFtsH2; Flags: Precursor >gi|52075838|dbj|BAD45446.1| putative FtsH-like protein Pftf precursor [Oryza sativa Japonica Group] >gi|125556417|gb|EAZ02023.1| hypothetical protein OsI_24055 [Oryza sativa Indica Group] >gi|125598182|gb|EAZ37962.1| hypothetical protein OsJ_021445 [Oryza sativa (japonica cultivar-group)]
Score 1893
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25093
GTTCGAATGCCGAAACCTGACAAAGACCATCCAAGGCTCTTTTTCTTCCCCTCTGCATCAGGAGAAAGCAGAGTTTCCCTGCCAATGGGAAACCAGGAGC
TCTCGCGCAGAAATCCTTCCCAAGTAATTACATCTTATAATTAACCGCGAGTGAGTTACATTACATGGCCGTGCCTCCAGTAGGAATTAGTGTACATCCA
AGAAATATGAACATCTTACAACAACAACAAATTCTCCAACCCTATAAACGCGGGCAAACCTAGACCGGGACGGCCGCCTGGGGCGTCGGGGGCACCCGGT
TCTCGACGGGGATCTCGGTGAACTCGGACAGGATGGCCCGGAACTCGTCGCCGCTCAGCGTCTCCTTCTCCAGGAGCACCTCCACGATCTTGTCCATGGC
CACGCGGTTGTCCCTCACCTGCTGCAGGGCGATCTGGTAGGCCTGGTCCGACAGCTGCTTCACCGCCGAGTCGATGTCCAGCGCCAGCTTCTCCGACATG
GAGTTCCGAGCCATCATCCGCATGATCACGTCCCCGCTCTGCGCCGCGTCCATCAGAGACCACGGGCCGATGTCCGACATGCCGAACGTCACCACCATCT
GCTTGGCTAAGCCGGTGATCTGCTGCAGGTCACCGGCAGCTCCAGTGGTCACCTCAGAATCTCCGAATATGATCTCCTCAGCAGCTCTGCCGCCAAGGCC
GCCGACGATTCTGGCAAAGAGCTGCTGCCTAGAGATGAGCGTTGGGTCATCCATGGGAATGAACCAGGTGAGACCACGGGCTTGACCCCTTGGAACTAAG
GTAACCTTCTGGACGGGGTCGTGGCCAGGCGTCAAAGTTCCACAAACTGCATGCCCAACTTCGTGGTAAGCAACAAGGCTTTTGCTCTTCCCATCTGTCA
TGACAGTTCCTTCCATACCAGCCACTATTCTGTCGATTGAATCATCAATCTCCTTCGAGGAAATTCCGGTCCTCCCACGTCGGCCTGCTAATATGGCTGC
CTCATTCAGAAGATTCGCCAGGTCTGCTCCACTGAACCCAGGTGTTCTCATTGCAATGACCTCAAGGGAAACATCAGCATCGAACTTCTTGTTGCTACCG
TGCACCTTGAGAATCTCTGTCCTTCCACGTACATCAGGAACATCAACACTCACCTGTCTGTCAAAGCGTCCAGGTCTAAGTAAAGCGGAATCCAAAATGT
CAGCCCTGTTGGTGGCAGCAACAACAATGATGCCAGTGTTTCCCTCAAAACCATCCATCTCAGTCAGTAGCTGATTGAGAGTCTGCTCCCTTTCATCGTT
CCCACCACCGATACCTGTTCCTCTTTGCCTCCCAACAGCATCAATTTCATCAACAAACACTATGCAAGGAGCATTCTCCTTGGCCTTCTTGAAGAGATCA
CGAACACGGGAGGCACCAACACCAACAAACATCTCCACGAACTCAGAACCCGATATCGAGAAGAATGGCACGCCAGCCTCTCCTGCGATCGCCTTGGCAA
GCAAAGTCTTACCAGTTCCAGGAGGACCAACAAGCAGCACACCCTTGGGAATGCGGGCACCAAGCGGCGGTGAACCTCTCTGGCTTCTTCAGGAACTCAA
CCACTTCCATGAAGTCCTGCTTTGCTTCGTCAACACCAGCAACATCATCGAACGTAACACCGGTGTTGGGCTCCATCTGGAACTTGGCCTTGGACTGGCC
AAAGCCAAGAGGAAAGCCAGGCCCACCGGGTCCACCCATGCCACCAGATCCTCCTCTCCTCGACAGCAAGAACAGACCGCCGATAAGGATAAGCGGGAAG
GCCAAGTTCCCGATAAGGTTGAAGAGGAGGTTACCGGAGTCCTCCTGCTGGTTGTGTGCAGCAAAGTCAATGTTCTTCTCCCTCAACTTCTGGAGAAGCT
CCTGGCTGAGGCCGGGAAGCTGCACACGGACCCTCTGCACGCGGTTGCCGAGCTCGGGAGAGATAGCCTCCACGATAGCAATGGTCCCGTTCTCAAACAG
GTCGACCTTCTTCACCCTGTCCTTGTCGAGGTACTCGAGGAACCTCGAGTAGGACATCCTGGAGGAAGACACACCTTGGTCATCGGCGAGAGCCTTGTTG
GCAGTCAGCAAGGCGGGCAGGCCGACTCCTCCGAGCGCAAGCTTCAGGAGCTTCCTCTTGGAATCGTTCGGCTTGTGCTCCAGGGAGGCGGTCACGGACA
CCGGCCTCTGTGCGACGCCGCTCGAGGGGAGCGCTCCGAAGGGGAGCAGCCCTTTCGCTGCGAGACTCATGGATGGCGCCATGTTTGCTTACTGAGACGA
GCTGGATCGGGGCCGGGGCGGAGGAGGGATGGGGGAAGGGGGCGATTGTGAGGGGAGAGGGGTGAGCCGAGCCGAGCGGAGCGTATAAGTAGCGGGCAGG
ACTGACTGGCCGACGAGGAGCTAGCGGCCGC
page-top