Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25091  (registered. 2007)
Contig Information
Length 2648 bp
Clones 60 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 10
Wh_RDr Root of dessiccated seed 7
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calnexin precursor [Zea mays]
Score 2005
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25091
AGGATGTTCGGTCCCAGACTGACCAAGAACATCGCATGAAAGATACTCAAGTTTGGCTTGATTCTATAACTCGCTGGAAATAGAATCACTAAATTTGCCA
TATTAAAATGCCTTAGAAACAGTACAAAAATTGGATGCGGAGCAGAGAGACAAAAAGACAGGCAATACACTAAGCCTATAATAAACCTCAAAAGCAAATC
CATTCTCGGATATCTATCAGTTACAGCGAGCTGATCAAAACCAAGCCATGACAGTATCTCCCAATCAATCAACAACAGGCTTATGCAACTCAACATGACC
ATGGGTGAGTGGCCTCAGATTTGGAGCTCAGGCTTTGCTAGTCACTATTAATCATGAAAAGCCATGAAAAAAGAAAAGCATCCCTCAAGCCGCAGCCGAC
TTGCGCAGTTCACTCTCACCATGAGCGAAGTGGCATCTGTCTCCAAATGTGCAAGAGCCTTTGTTGAAGTTGTCACACAGCTTGGTCTTGAAGTTGCTTC
CCCCACCACCACCTGCAGGCCCCCTCCCCGGGTTCTTTGCTTGAGGAGGGGCGTTGCCGCCAATGCGGAGAATCAGCTCTTTCACCATTGCACTCGCATG
GTTGACCTGATCGAACGATCCCTCGAGCTCAATGTTTTTATGGTTGGGGTCTGCCTCATTATCCCGGATGGCTAGCTTGGCCCCAGTCATTCGGGATATG
TGCTTCGTGTTGACTCCACCTTTCCCAATAATGGCGCCAGCAAGGGATGCATCAACACTGATCCGGTTGCGCTTGCAGAGAGATCGGGTCTGGGAGGATG
ACGACGGGAGGGCGCGCGGTGCTCCTACTGCCGCTTCTGGTGGCCTCGGCGCTGTTCGCGCAGATCCGCGCGTCGGATCCGCTGTTCCACGAGTCCTTCG
ACGAGGGCTTCGAGGGGAGCTGGGTCGTCTCCGGCAAGGAAGAGTACTCAGGTGTATGGAAGCACGAGAAGAGTGATGGCCATGAAGACTATGGTCTCCT
TGTCAGTGAGCCAGCCAGGAAATATGCCATAGTCAAAGAGCTTGATAGCCCTGTTACTTTGAAGGATGGGACAGTTGTCCTGCAGTTCGAAGTGAGGCTT
CAGAATGGCCTCGAGTGTGGAGGTGCTTATCTTAAGTACATTCGCCCTCAGGAGGCTGGATGGGATGCCAAGGAATTTGACAATGACACTCCTTACACAA
TTATGTTTGGTCCTGACAAGTGTGGTTCAACGAACAAGGTTCACTTCATCCTGAAGCACAAGAACCCCAAGACTGGCAAATATGTTGAACATCACCTCAA
GTCCCCACCCTCTGTCCCATATGACAAGCTCTCTCATGTCTACACGGCTATCTTGAAGCCGGATAACGAGGTCAGAATTTTGGTTGATGGGGAGGAGAAG
AGCAAAGCAAACTTCCTGTCCGCTGACGATTTTGAGCCAGCACTTATTCCATCAAAGACTATTCCTGACCCTGACGACAAGAAGCCAGAGGACTGGGACG
AGAGAGCTAAAATCCCTGACCCAGCTGCAGTGAAGCCTGATGACTGGGATGAGGATGCCCCAACAGAAATTCTGGATGAGGAGGCCACCAAGCCAGAAGG
ATGGTTGGATGATGAGCCTGAGGAAGTTGATGACCCAGAGGCTGCTAAGCCCGAAGACTGGGATGATGAGGAGGATGGCGAATGGGAGGCACCGAAGATC
GACAACCCCAAGTGTGAAGAGGCACCTGGATGTGGTGAATGGAAGAGGCCAATGAAGCAGAACCCTGCCTACAAGGGCAAGTGGCATGCACCCATGATTG
ACAACCCCAACTACAAGGGAATCTGGAAGCCCCAAGAAATCCCCAACCCTGAATACTTTGAGCTTGACAAGCCTGACTTTGATCCGATTGCCGCTATTGG
AATTGAGATCTGGACAATGCAGGATGGCATCCTTTTTGACAACATTCTTATCGCCGATGATGAGAAGGTAGCCACCGCCATCTTGGAGAAGACATGGAAA
CCCAAGTTTGATGTTGAGAAGGAAAAGCAGAAGGCTGAGGAGGCTGCAGCAGCCGATTCAGAAGACCTTTCTGAGTTCCAGAAGAAGATCTTCAGTGTTT
TGTACAAAATCGCCGACATTCCATTCTTGGAACCTTACAAGATAAAGATCATTGATATTATTGAGAAGGGAGAGAAGCAGCCCAACATTACAATTTCGAT
CTTGGCCTCAGTCGCTGTCATCCTTGTGACTGTACTCTTCAGAACCATTTTCGGTGGCAAGAAGCCAGTGGCACCTGTGAAGCCCGTTGCCGAGGTCAAG
AAGCCCAGTGCCACGGAAGCCGATGCCGCTGGAAGCAGCGGCGACAAGGAGGAGAAAGAGGATGACACGACGGTGCCACGCAGAAGGTCGCGAAGGGAGA
CATAGGCTCACATTTCGGACGTCTCGGTCCTGGCCTTTTTGTGAACTCCTCGAGTGTATAATCGAACAGTCTTGCTGCCCTCTGCTGCTACCCCTAGTTT
TAAGGCGCTAGAACCTACGAGCCGGTGAAGCCTTGTGTTGTTTGTGTGCTGTCCGGAATCAGCTAGAAGTGATCTTCTTTTCCTTTTGTATCAAACGAAA
CTTGAAAGGATATTTTGATATTTAGATGCTGTTCATTTAAAAAAAAAA
page-top