Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25086  (registered. 2007)
Contig Information
Length 1942 bp
Clones 60 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 60
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase; AltName: Full=Beta-Amy1; Flags: Precursor
Score 2431
Evalue 0
Total Hit Count 315
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25086
TTTTTTTTTTGAGCACAAAATAGTTTGTTCATTCACTCATATGCACATAATGGAGGTATGTAAGGTCTGATGTACTACAGCTCATTGGAAAAGCATCCTC
TTGATGACTAATCCAATATTGATGAGTAATCCTCATGATGTACTGTAGCACCACATCTTATTTATCCTCATCGGCTTATTTCTAGGGCACGGTTAATTCT
CACAAAGAGAAGATTAACCCTTCCAGCACTGAGATTTTTCTTCCAGAACACGCACAAGTGATGTGCTTTATTTATTGCTATTAATAAGGCAGAGAAAGGT
TTCTCTGTCACACACAACATAAAAGGTACTGTAGATCATAAAGGTTTCATTACACGGTGGCAGGGAGCTCCCCACCCATGCTACCAGTGGGGTCTTGAAC
CTCCCCACCCATGCCACCAGTGGGGCCTTCAACATCCCCACCGATGCCACCGAGGCCTTGAACTCGCAGGTCGGTGTGCTCTTCAAAGGGGAATGGATCC
AGTTTTGGCTGCGCTGCTTGTAGGATCATTTCAATCGTCAGTTCTGGCCCTGATCTTTGCAAAGGCGCCACTGGATCAACACATGGGTCATGAGGCAGGT
TGGCATGCATTCTGTCAACAAAGGTCTTGAAATTGACATAGTTTTGTCCCTCCACCAACTGATTCGACAGCCGGAGGTAGGTGAATCCAAACAGCTTGTG
CTCAGGAGGGCCGCTCTTGTTGATGCCATGAGGCCTTGCATTCCTGAGTATGGTGTTGTAAGCAGTTGGATCATATCGAGGAAGTGCATTTTCGCATGCC
ATATTTAGGCCCTCTCTCCATCCAGCACTCAACACCTGTTGGACTAGTTCTTCCGGTGCGCTCATGGCCTGTGAGCTTTGCTCCGAGTCCCTCATCTCGG
CGCAAGTGAAGTTAAGACTAGCACGGTGCCTTTTGAGCATGCGTGCTATGGGTCTGTAGCCATCTCTATCATGTAAGTTGTAGTACCCAGCTGTGATCTC
GGCTGCATGGCTTGGAACCTTGTACCACCAGTGAATGCCAGAGATTTTGATTGCCAGTTGCACTCTGTGTCCCAAGAAGACCTTGTTTGCTTCGTCCAAG
ATCTTGTCACCGTGCTTGATCAGGTTATTGGAGTACCATGCAAGGAAAAACCTCCCCTGCTCAGTGAGATATGTTCCGTTGTCCACGAAGAATCGAGTTC
TCTGGGGAGTGTCATTGTACTGTCCGGCATCGCGAGGAAATTCCCACTCAGGATGGCCAACCATCGCTGCTGCTGCTTTGAAGTCTGCTTGCAGGTACTT
ATCATAGCAGATGAATTCTCCGATGCCTGGGAATGACCATCCATGGCTCTGAGGATAGGATGGGTACCTCAACTCTCCAGCCGGGCCAAGTCCGACTTCA
ATGTCTACAATAACACCGGCATCCAAGAACTCTTTCATGTTGTCCCTGAAGCTTGCCATGTAATCAGTATACATCTGGACGGCAGATCTTCCATGGAAGA
GAGGCTGGTCATCAACTCCAAGGGTGAGGTACTCAATGTTCCTAGTCCCGTGCTGGTCGGTGTAGAAAATGTCCGGATCACTCGCACCGACATTCCGCAC
CCACTGCGGGATCGGGATGTTGACGACATCACCGACGTTGCCACCACACTGGTGGAATGACATGATGGCCTTTAGCTTCAGTCCAGCCTCATGCACCAGC
TGGAACAACTGCTTGTAGGCGGACCAGTCGTACGCCCTGGGGCCCTTGGCCTCCACCAAGCCCCACCAGACGTCTACCATGACACCATCCACACCGGCCT
CTACCAGCCTCTTCAGTTGCTCCCTGAGCTCGTCACCCTTCTCGAACCTGTTGTTCACGCTCACGGCGTCCAGAGGGAGCATGACGTAGACTTGGACATA
GTTGCCTTGTTGCACGCTCGCTTCCATTGTGGCTGCTGGCTG
page-top