Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25077  (registered. 2007)
Contig Information
Length 1477 bp
Clones 59 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 8
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L3 [Triticum aestivum] >gi|34105770|gb|AAQ62076.1| ribosomal protein L3 [Triticum aestivum] >gi|34105774|gb|AAQ62078.1| ribosomal protein L3 [Triticum aestivum] >gi|118152389|gb|ABK63938.1| ribosomal protein L3-B3 [Triticum aestivum] >gi|118152400|gb|ABK63944.1| ribosomal protein L3-B1 [Triticum aestivum] >gi|146141392|tpg|DAA01144.1| TPA_inf: ribosomal protein L3B-3 [Triticum aestivum] >gi|146141396|tpg|DAA01146.1| TPA_inf: ribosomal protein L3B-1 [Triticum aestivum]
Score 1988
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25077
CGTGCCCTCCTCCTCCACACACCACCCTCCCCCATCCGCCGCCGCCTCCACCTCCACCTCCACAGGGAAAGGAAGGGAAGATGTCGCACCGGAAGTTCGA
GCACCCGAGGCACGGATCCCTCGGTTTCCTCCCCAGGAAGCGGTGCTCGCGCCACCGCGGAAAGGTGAAGGCCTTCCCCAGAGATGACCAATCCAAGAAA
TGCCATCTCACTGCCTTCCTTGGCTACAAGGCTGGGATGACTCACATTGTGCGTGAGGTCGAGAAGCCTGGTTCCAAGCTACACAAGAAGGAGACATGTG
AGGCTGTCACCATTGTTGAGACACCCCCGATTGTTATTGTTGGACTTGTTGCCTATGTGAAGACTCCTCGTGGCCTTCGTACTCTCAACTCTGTCTGGGC
ACAGCATCTCAGCGAAGATGTGAGGAGAAGGTTCTACAAGAACTGGTGCAAGAGCAAGAAGAAGGCCTTCACCAAGTATGCTCTGAAGTATGACAGTGAT
GCTGGCAAGAAAGAAATCCAGATGCAGCTTGAGAAGATGAAGAAGTATGCTACTGTTGTCCGAGTTATCGCCCATACCCAGATCAGGAAGATGAAGGGGT
TGAAGCAGAAGAAGGCTCACCTCATGGAGATCCAGATCAATGGTGGCACCATCGCTGACAAGGTCGACTATGGTTACAACTTCTTTGAGAAGGAAGTCCC
CATTGATGCTGTATTCCAAAAAGATGAGATGATTGACATCATTGGAGTTACCAAGGGTAAGGGTTATGAAGGTGTTGTGACACGTTGGGGTGTCACCCGT
CTTCCCCGCAAGACCCACAGAGGTCTTCGCAAGGTTGCCTGTATTGGTGCCTGGCATCCTGCTAGGGTGTCCTACACTGTTGCTCGTGCTGGTCAGAATG
GATACCACCACCGAACTGAGATGAACAAGAAGGTCTACAAGATTGGCAAGGTTGGACAGGAAACTCATGATGCCTCTACTGAGTTCGACAGGACCGAGAA
GGACATCACTCCGATGGGCGGCTTCCCTCACTATGGTGTGGTGAAGGCTGACTACCTGATGATCAAAGGATGCTGTGTCGGCCCCAAGAAGCGCGTGGTG
ACCCTCCGCCAGTCCCTGCTGAAGCAGACCTCTCGTCTGGCCCTGGAGGAGATCAAGCTCAAGTTTGTCGACACCTCTTCCAAGTTCGGCCACGGTCGCT
TCCAGACCACAGACGAGAAGCAGAGGTTCTACGGCAAGCTCAAGGCTTGAGCTGCCGCCGCGCATCATCAGTTATATCATTTTGTCAAAACGAACATGTG
ATACTTGATTACTTCCCCTGCCTAAGTTTTGTACTAGTTGATGTTTTCAGAATCTGGCTCATCTATGAATTCTTCGTGTCATGTGCTATTGTTATTGTGA
TTTAGCTGTTGAAACCTATTTAGAGTCGTACCTTGTCGCAAATTTTCTGAAATGAGTTTGCTTGCCTAAAAAAAAAA
page-top