Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25070  (registered. 2007)
Contig Information
Length 774 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 8
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VSCB Liquid cultured tissue 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L17-1 >gi|19102|emb|CAA44598.1| ribosomal protein L17-1 [Hordeum vulgare subsp. vulgare]
Score 867
Evalue 2.71834e-91
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25070
TTTTTTTTTTGCTAATAGCAAACTAGCACTCATACGATGAAAAATATTCCAAAACACAACCAGATTGAATCCAGTACATGAGACGATCATCAAAAGGTTT
CACAAAGTATGAGCTAGCAGTATTTAGACGACAGATAATAGGCCAAAAATTTCGACTCAGCCAGACCAGATGCTACAAACTGCTCTAACGAATAGGCAGA
TAGGTTATGTAGAGCTTCCTTCTCTAGGCCTTCCTGGCAATCTGGGACTCAGCCTCCTTCTTCACCGGCTCTTCCTTCTCCGACAAGATCAGCTCAATGT
GGCATGGGTTGGACATGTAGGGGTTGATGCGTCCATGGGCACGGTAGGTCCGGCGCCGCTGCTTCTGGGCCTGGTTCACTTGGATGTGTGAAATGTAGAG
AGCATCAACATCAAGACCTTTCACCTCAGCATTGCTCTCAGCATTCTTTAGAAGATCCAGAACGAACTTAGCAGACTTGGCAGGCCAGCGTCCCTGACCA
TTGGGCTGACGGTTCTTCACCTGGGCTGTGCGTCCAACACCACGGCAGTACCTCCGGAAGGGGATGGCTTGCTTGTGTGCCAACACATCCTCAAGGTACC
TCTTGGCCTTGTTGAGCGACATCTTCCTCAGGGCAAACGCTGTTTCCCTAGTGTTCTTGAAATGAACACGCAGGTCCCGGCCCATGGCCTTGGCGGACTT
GGTGGGATTGGCGGGATCCGTCGAGTACTTCACCATGGCTGCGGCGGTGCAGTAGAGAAGGCAGCGGCGGCGGC
page-top