Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25066  (registered. 2007)
Contig Information
Length 1206 bp
Clones 58 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 6
Wh_V4816 Shoot grown under cold condition for 16days 13
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0704900 [Oryza sativa (japonica cultivar-group)] >gi|122171022|sp|Q0DYB1|IPYR_ORYSJ RecName: Full=Soluble inorganic pyrophosphatase; AltName: Full=Pyrophosphate phospho-hydrolase; Short=PPase >gi|158512873|sp|A2X8Q3|IPYR_ORYSI RecName: Full=Soluble inorganic pyrophosphatase; AltName: Full=Pyrophosphate phospho-hydrolase; Short=PPase >gi|41053143|dbj|BAD08086.1| inorganic pyrophosphatase [Oryza sativa Japonica Group] >gi|113537394|dbj|BAF09777.1| Os02g0704900 [Oryza sativa (japonica cultivar-group)] >gi|125540818|gb|EAY87213.1| hypothetical protein OsI_08617 [Oryza sativa Indica Group] >gi|125583395|gb|EAZ24326.1| hypothetical protein OsJ_007809 [Oryza sativa (japonica cultivar-group)] >gi|215678927|dbj|BAG96357.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215686447|dbj|BAG87678.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697839|dbj|BAG92032.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1066
Evalue 4.71276e-114
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25066
TTATATCGCGGCATCGGGTCCTGCGCTGCGCGCCTGCTGCTGCTCCCTCGCCCTCGCCTCCGCTGCCGTCGCGCGAGATCAACCCCGCCGCCATGGCTGG
AGAAGCTGATGGGAAGACCTACCAGGTATCAAGGATGCCCCCTGCTGCTCTCAACGAGCGCATCCTTTCTTCCATGTCTCAAAAGCACGTTGCTGCTCAC
CCATGGCATGACCTGGAGATAGGTCCAGGGGCCCCTGCAGTTTTCAACTGTGTGGTTGAGATTCCTAGAGGCAGCAAGGTTAAGTATGAGTTGGACAAAG
CAACTGGTCTTATCAAGGTTGATCGTGTTCTGTACTCCTCAGTTGTGTACCCACACAACTATGGCTTCATTCCACGCACACTCTGTGAGGATAATGACCC
GATGGATGTCCTTGTCCTGATGCAGGAACAAGTTGTTCCTGGTTGCTTCCTGCGTGCCCGTGCTATTGGGCTTATGCCTATGATTGATCAGGGTGAGAAA
GATGACAAGATCATAGCTGTCTGTGCTGATGATCCTGAGTACCGTCACTTCAGAGACATCAGTGAACTTCCCCCGCATCGCCTACAGGAAATCCGTCGCT
TCTTTGAAGACTACAAGAAGAATGAAAACAAGGAGGTTGCAGTGAATGATTTCCTCCCAGCAGAAGATGCCATCAACGCAATCAAGTACTCGATGGACCT
CTACGGTTCGTACATCATGGAGGGCTTAAGGAAGTGATCTCCAGTTGGCGGACTGCGGATGCTACGCGATCCGCCCTACGGCTTATCAATAGTACGACAA
ACATCTATGTTAACATGATGATCGAAAACCATCAGTCTGTTGGGGATCTATATATACCTTCTGTCCATGCTGAGTCAAGCATGGGTACATTTTCCTTCCG
TATATGCCATGTCAGGTCCAAGTATTTGACCTCTTGCTGGAACCTTTTTTGTCAAACCGTCTCTTGACAGAGCGGCTGCTTAATAGGAAATCAGCGTTAC
GCGAAGGCGCGTATGCGTGCCTCCAGTCCGTTTAACCGTGTGATATCTTGATGTTGTGTGGTATCCGCTGGTTTTGCTTTCCCTGGGTTCTTTTTTTCCA
TTAGTTTTCTGTGAACGTCCGTAGCTGTTGTCGCCATCATGGAATCCTGTGTAGTCTTTGTCACAGGAGTTCAGAGCTGTTGGAACTTTTTCAAGGAAAA
AAAAAA
page-top