Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25060  (registered. 2007)
Contig Information
Length 1007 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 12
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 11
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cobalamin-independent methionine synthase [Triticum monococcum]
Score 986
Evalue 6.81401e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25060
CATCTTACTTAAGTCTGGGCCCAAGGCCACACATTGCACACACACGCTTACATGGCCGCGGCCCAACACTACAATTGCACTGAGTGCCTCGCTGTACGCT
TCAGGGTTCAGTTAACTGCTGGACTGAACCTGAAGGCGTTACACCAACACAGCCAAGACAAGAACATCCGGAGAAATTTTGTAATTTGAAAACGTAACGT
AACAAACTCAAGACTTAGATGATGAACAATTCGCCACTCAGTTTACAATACACACCGACAACCGCCTCAAAAACCACCAAATCAAAGGGATGAGCACATG
GCGCCGCGCCGCGCCGAGAAACAAACTAGCCTAACCAACAGGTGGATACAGAGACCCAGATTATTCAAAGTAAACACGGCTATGGTGGCGACATCCTCCT
TGCAATTAAAATGGGGGAGCTGCTATACGGCTTACTGCGCCTTGGCGAGCTCGGCGCGGATCTGCTTGGCGGCCTCGACCATGTTGGTGAGGGCGGGCTT
GACCTCGGCATACTTGCGGGTCTTGAGACCGCAGTCGGGGTTCACCCACAGGATGTTGGTGTCGAGCACCGCGAGCATCTTGTTGACACGGTCGGCGATC
TCCTCCTTGGACGGGATCCTGGGGGAGTGGATGTCGTACACGCCCGGGCCAATGCCGGCGCCGTACACCACGCCCTCGCGGAAGACGGAGAGAAGCTTCT
CGTCGGACCGCGAGTTCTCGATGGTGATCACATCGGCGTCCATGTTGATGATGGACTGGATGATGTCGTTGAAGTTGGAGTAGCACATGTGGGTGTGGAT
CTGGGTGGTGTCCTGGACACCGCAGTTGGTGATCCTGAAGGAGTGCACGGCCCAGTCCAAGTAGAAAGCATGCTCCGACTTGCGGAGTGGCAGACCCTCT
CTCAAAGCAGCCTCATCGATTTGGATAACCTGAATACCACCAGCCTCAAGGTCCTCGACCTCCTTCTTGATTGCAAGAGCAATCTGGTAGCAAGTCTCAA
ACCTCGG
page-top