Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25053  (registered. 2007)
Contig Information
Length 949 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 384
Evalue 3.94403e-35
Total Hit Count 60
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25053
GTCCCACTCCATCTGGTGCTGCACTTGTGGCAAGCATATTTAAAGGGAACAACGGATTACAGATGCAACAGGCATATCAAGCTCTCAAAACCATACAAAT
AAATGAAGTCGCAACACACCATATTCAAACTCCATATTTATAAACCCACTGCCATGAAGGTAATTCCAACATCAATACAAGGGAAATACTCCCGGGACAA
CAGAGACCACGAACTAGGGTAGGTAATAGACACAAGCTGTGGCATAGGTTCATAATATTGCCAATGAATTATTTAGGAGATATATATCATCATCATCATG
ACTGAAAACAGGTTCTGCCCAATTAAGCCCCAATCAAGCAAAGATAGTAGCTTAAAGAGTTGCTCCTCCACGGCGGCACTCGTTCAGCATGTCAAGGTAG
AACTGGCACTTGCTGATATCGCTTCCGTAGTGGTTGATGCAATCTTGGAAGGCCTTGGAAGGGTTGCCACACTTGTCATCAGCAGCATTGTCCATTGGAG
TCATAGATGCAGCAGCCTCACCGACAACAGTCTCATGCTGAATGGTACGGGGACCCATCACAGCATCAACAGCCCTGTGCGCCATGGCACTTCCAGTACC
GAAAGCCATGCCCTGAGCAATGGTGGACCCAATCCCGCTCATGATACCACCACCGCTGCTCTGGGTGGTAGCAGGTGGAGGAGCTGGACGGGCTGGCGCT
GGTGGGTTTCTCACTGGAGCAGCACGTGGAGCAGGGCGGGAAGACCTTCCTCCTCCGCTGCGGCGGGCCATGGCGGCGGGTGGGGCGGACGGGCGGCGGG
AGGAAACCCTAGGCTGGAGGCGGCGCCGGGAGGGGGAATGGATGAACAGAAGCCAACGGATCGGGCCGTTGTTGCCACGAGAGCTGTGATCTTGTACTCC
TGAGGGGAACCTCGTGTACTTNGTCGGAACTATGGTAAGCATGCATTAC
page-top