Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25052  (registered. 2007)
Contig Information
Length 1133 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 17
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|15408693|dbj|BAB64099.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|20160872|dbj|BAB89811.1| putative photosystem II subunit PsbS [Oryza sativa Japonica Group] >gi|113534460|dbj|BAF06843.1| Os01g0869800 [Oryza sativa (japonica cultivar-group)] >gi|125528521|gb|EAY76635.1| hypothetical protein OsI_04589 [Oryza sativa Indica Group] >gi|125572786|gb|EAZ14301.1| hypothetical protein OsJ_004126 [Oryza sativa (japonica cultivar-group)] >gi|215701291|dbj|BAG92715.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737433|dbj|BAG96563.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215764949|dbj|BAG86646.1| unnamed protein product [Oryza sativa Japonica Group]
Score 818
Evalue 2.44977e-85
Total Hit Count 221
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25052
AAGTCCCCCAAGATATAGCTCCCCACAGCCACAGACGCGCGAAGCCATATCCCGGGACTCACGAGTACGTGCGTGAGCGAGTGAGCGTCTAGGCGGCTAT
GGCACAGCTCGATGCTCATGTCCGGCGTCAACGGCGTGGCCTCCGGCAGGAGCCTGCTGCAGGCGGCCCGGCCGTCGACGGCGTCCACGCCCTTCTCGCG
GCTCGCGCTCTCCTCCTCGTCGGCGGCGTACTACAAGCACATGCCGTCCCTCTCCGTCCGGACCATGGCTCTGTTCGGCAAGTCCAAGACCAAGGCCGCG
CCGGCCAAGAAGGTCGCTGCGCCCAAGCCCAAGACGGAGGACGGCATCTTCGGCACGTCCGGCGGGATCGGTTTCACCAAGGAGAACGAGCTCTTCGTCG
GCCGTGTTGCCATGATTGGCTTCGCCGCATCGATCTTGGGAGAGGCCATCACCGGCAAGGGCATCCTGTCCCAGCTGAACCTTGAGACCGGCATCCCGAT
CTACGAGGCGGAGCCCCTCCTCCTCTTCTTCATCCTCTTCACCCTCCTCGGCGCCATCGGCGCTCTCGGAGACCGTGGCAGGTTCGTCGACGAGCAGCCC
ACCACTGGCCTCGACAAGGCCGTCATCGCCCCCGGCAAAGGCTTCCGCTCCGCCCTCGGCCTCAGCGAGGGAGGGCCGCTGTTCGGGTTCACCAAGTCGA
ACGAGCTGTTCGTGGGGCGGCTGGCGCAGCTGGGGATCGCCTTCTCCATCATCGGGGAGATCATCACGGGCAAGGGCGCGCTCGCGCAGCTCAACATCGA
GACCGGGGTGCCCATCAGCGAGATCGAGCCGCTCGTGCTCTTCAACGTCGTCTTCTTCTTCATCGCCGCCATCAACCCCGGCACCGGCAAGTTCATCAGC
GGCGAGGAGGACGACTAGATCGGCACCGGCACGAGCGAATGCTTTTTGGCCATTAATTGTACGTCCGTTCGTGCTTTGCTTGTTTGTTGTGTACGTGAGA
CCTTGGGGTGTACTTAGGTGTAAGAAGAAGTTGGTCGTTGCCTTATGAAAAACAAGAGCTAGCAGCTAATTTGCCATGCATGCCGAACGGTTGCAGATCT
ATCGTCTCGGATTNTAGATCATCCCCTTCTCCC
page-top