Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25049  (registered. 2007)
Contig Information
Length 956 bp
Clones 57 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13062 [Oryza sativa Indica Group]
Score 367
Evalue 3.73229e-33
Total Hit Count 86
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25049
GCATATTTAAGGGAACAACGGATTACAGATGGCAAGCTCTCAAAACCACACAAGAAATGAAGTCGCAACACACCATATTTAAACTCCATATTTATAAACC
TGGTGCCATGAAGGTAGATCCAACATCAATACAAGGGAAATACTCCCAAGACAACAGAGACCACAAACTAGGGTAGGTAATAGACATAAGCTGTGGCATA
GGTTCATAATATTGCCAATGAATTATTTAGGAGATATATATCATCATCATCATGACTGAAAACAGGCTCCGACCAATTAAGCCCCAATCAAGCAAAGATA
GTAGCTTAAAGAGTTGCACCAGCTCCTGCTCCTCCACGGCGGCACTCGTTCAGCATGTCGAGGTAGAACTGGCACTTGCTGATGTCGCTGCCGTAGTGGT
TGATGCAATCTTGGAAGGCCTTGGAAGGGTTGCCACACTTGTCATCAGCAGCGTTGTCCATTGGAGTCATAGATGCAGCAGCCTCACCGACAACAGTCTC
ATGCTGAATGGTACGGGGACCCATCACAGCATCAACAGCCCTGTGCGCCATAGCACTGCCAGTACCAAAAGCCATGCCCTGAGCAATAGTGGACCCAATT
CCGCTCATGATACCACCACCGCTGCTCTGGGTAGTAGCAGGTGGAGGAGCTTGACGGGCTGGCGCTGGTGGGTTTCTCACTGGAGCAGCACGTGGAGCAG
GGCGGGAAGATCTTCCTCCTCCGCTGCGGCGAGCCATGGCGGCGGGTGTGGCGGACGGCGGGAGGAAACCCTAGGCTGGAGGCGGCGGCGGGAGGGGGGA
GCGGATGAACAGGAGGCCAACGGATCAGAATCCTCGTGCCGAATTCGGCACGAGGATCCCTACACAGCCGACCATCGTGCCGGGCACCGAGATGTACCAC
TGTGCTTGGGGGTTCTTCCCCCTTGGNTTCNCCAACTCGGCGGATCTGGGTGGCAA
page-top