Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25039  (registered. 2007)
Contig Information
Length 1797 bp
Clones 56 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 6
Wh_MS Seed DPA5 of DT3DL CS wheat 9
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 6
Wh_SHDr Shoot grown with dessication 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aspartic proteinase [Triticum aestivum]
Score 1213
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25039
TTTTTTTTTTCTAGAAGGCAAACGTTGTTTATCACATAATAATTCAACATCTTCGGGGCAAACGTCCACAAACAGTCTTGCCATCTTAGGAACAACCCTT
GGTCATGTCAGGGTCTTTGAAAAGCAGCATGTAGCATATATATACACACACAGCACCGGTCAAATTCGGAGTAAAAAAGCTAAGCTCTCTCCCGGCGCAA
GTGTTCGCCTCCGCGGTGGGGCGCTCGCTCGACCACCCTTTCAGGCCGCCTTGGCGAATCCGACACGCAGCTTGCCGTAGTCGAAGACGGTGTGGTAGGG
GCCCATGAAAACGTCTCCCAGGATCCAGAGAGGACCGCGAGGAGGCGGGATGTCCATGGCTGTGAATCCACTGATGCACTGGGCAGCAGCTCCTTCGCCA
ACCTTCAGGATATACTCTTCTGGTTTCAGCGCAAACTTCTTGCCACTAATGGTGAACTCAATGTCAGGCATGGATCCAAGGCTGGCACAGTCCACAGCTG
ATTCTCCCATGGGGCTTGGCAGACGGTTGCACAGCTGGTTAACGTAATCTAGTATGAGATCCTGGGTCTTGTTCTGTGCAAGTTGGTTCTGCATCCACAC
AACAGCCATCTCACAGGCACTGCACATGGGATCGGTATGGAGGCCATTCGATTTCACAGGCTCATCATCGACCACGCTCCGAATTCCAGCACTAACACCA
CGAGTCCCATCAAAGGTGCACAGACCAACCTGGGAGCAGACCTTTTTGGGCTGTGTCTCTGCTAGCAACAGGTCGAGGATCTGTTGTCCATACTGAGAAA
CAATTGTTTTGCACTCTTGGCTGACTACCCCAGCCGCACCAATCTTCTCGTTAATTTCAGTAATGATGGCCGTGGGACCAGCAAGCAATGAAGTTCCAGA
ATCAGCCAATTGCAGCACAACCGCCAGCACAGAATCCTGTGGACTTCCCTCCAACCAGGACATCACCCATGTCAAACTGCCAATATCCCTTCTGGGTGAC
TGGGACATATGTGTGTTCACCCACGTAGTGTTTAGGATCCATTCCTCCAAAAATAATTTCACCACCCTCTCCTTCATCATCAGCATGTCGGTTCAACCAG
AACGAGAAAACAGGATCACTGATGAGACCTTGCTCTACCATATTATACCACACAGGTACTGCTTTGCCAACAGATATTTCCTTAAACCCAAGCCCAAGAA
TACCATCAAACTTTGCAACCAAGAAAGTAACACCTGGCTCCTTTGTAGCTTCAATGAATTCCTGATCTTTCACAACTAGATCACCCACTGTAACACTATC
CTCACTGAAATATCCAGCAATTGAACCAGTGCCGTACTGAATGGCAGCAGGCTTTCCATTCTTCTTGTAGGTGCTGGACGCACCCGCCTTGTATCGTGCG
TGGAGGTAGCACGCAATCGAGAAGTAGCACTTGGCGGAGGGCACCCAGAGGTTGGAGCTGCCGGTGTCGAAGATGACGGTGAACTTCTGCGGCGGCGTGC
CGACGCCGATCTCCCCGAAGTACTGGGCGTTCATGTAGTTCTTGAGGGACACGATGTCGCCCTCCTCCTCGGAGCGGAGGGTGTTGGCGCCGCCGATGAG
GTGGTGCTGCCCCTCCTCGCGGCCGGAGAGGCTCGCGGCGACGCGGCTGTTCCGGTCGATGTGGCGCTTCTTCAGCGCGATCCGCACCAGGCCCTCCGCC
TCCGACGCCGGGAGGAGGGCCTGCAGCAGCACCGCCGCTAGGAGCAGCACGGCGAGTCCGCGGGTTCCCATGGTCGCGATCAGAAACCGGAGGAGGA
page-top