Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25037  (registered. 2007)
Contig Information
Length 1773 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 6
Wh_EMC Dormant seed with cold treatment after water absorption 7
Wh_EMI Dormant seed with water absorption after breaking 9
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 6
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 1128
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25037
ACCTTCAAATAAAAGAACAAATGGTTTAAGATGCATTTGTGTCTTTCAAAAATGCACTAGATAAAGCACCTACACAGATAAAATGCAACAAGCTAGTATT
AAAAGACACAACCAGGTCTCATAACATCCAGGGTTTCACCGAAGCTTACATTAGGACACAGTATGTAAAAGGCACAAGACAGACGACCACCAAGGGCACG
ATATGCAGCGCTAACAGCTGAACAGCTAAAATATACCAGTACGAACAATGCCCTTAACAAAACTCAGCCAATACTAAAAACTGCTTGGTGTCTGAACAGT
GATTTGGATATCAATGTCGAATTACTTCTTCTTGATGGCAGCCTTGGTCACCTTGGCCCCGGTTGGGTCCTTCTTCTCGACGCCCTTGATGACACCAACA
GCCACAGTCTGCCTCATGTCACGGACAGCAAAACGACCAAGAGGAGGATAAGTGGCAAAGGTCTCCACAACCATGGGCTTGGTGGGAATCATCTTCACTA
TGCCAGCATCACCATTCTTGAGGAACTTGGGCGCGGCCTCTATCTCCTTACCAGATCGCCTGTCAATCTTGGTCACCAGCTCAGCAAACTTGACAGCAAT
GTGCGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCGTTGCCAATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTGAAGTTGGCTGCCTCCTTG
GCAGGGTCATCCTTGGAGTTGGATGCAACAAAACCACGCTTCAGATCCTTCACGGCAACGTTCTTGACGTTGAAGCCGACGTTGTCACCAGGAAGCGCCT
CCAGGAGAGACTCGTGGTGCATCTCAACAGACTTGACCTCAGTTGTCAGACCAGTGGGACCAAAGGTAACAACCATACCAGGCTTGATGACACCAGTCTC
AACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACGTCCTGGAGGGGAAGACGGAGGGGCTTGTCTGAGGGCCTCTTGGGCTCATTGATC
TGGTCAAGCGCCTCAAGCAGGGTTGGGCCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCGAACCCAGAGATGGGGACGAAG
GGAACCTTTTCAGGGTTGTAGCCGACCTTCTTCAGGTAGGAAGAGACCTCCTTCACAATTTCTTCGTAACGCGCCTTTGAGTACTTGGGAGTGGTGGCGT
CCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGAGTGAAAGCAAGGAGAGCGTGCTCACGTGTCTGGCCATCCTTGGAGATACCAGCCTCAAA
ACCACCAGTGGTGGAGTCGATGATGAGAACAGCACAGTCAGCCTGGGAGGTACCGGTGATCATGTTCTTGATGAAGTCACGGTGACCAGGGGCATCAATG
ACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCAGAGGGCAATATCGATGGTGATACCCCTCTCACGCTCGGCCTTGAGCTTGTCAAGCACCCAGGCGT
ACTTGAAAGACCTCTTGTTCATTTCAGCGGCTTCCTTCTCGAACCTCTCGATCACACGCTTGTCAATGCCTCCAAGCTTATAGATCAGGTGGCCAGTGGT
CGTCGACTTGCCAGAGTCGACGTGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGGCTGAAGCTCTCGAAGGAAGGAGAGGGAACCGA
GAGGAGGAGGCGGCGGCGGCGGCGGCGGTCGGGGGGAAGAAAGGGGACTGAGGAGGGTTCGGGCGAGCGGAAT
page-top