Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25034  (registered. 2007)
Contig Information
Length 1727 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 10
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 6
Wh_SHC Shoot grown with cold treatment 4
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_21076 [Oryza sativa Indica Group]
Score 2365
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25034
TTTTTTTTTTATCCCGACGAACCAACTTTTATTATTCTGGAAACGAAGACGACTCACTCAGTCCACCACCAACAGGGGTCTCTCTCTACCTGACAGCAGT
TCACAACTTCAAACAGCTAGTCGCACGCATACATTACAGTCCATGAATTGTCCACCCATCAAAAAACAACTCTTCGGCCCCAAACCTAGGCAGACTGCCG
GAGCTCTGGGCGCACAAAGTCCGCGTCGGCCGTCACCGAGATGTCGACGGTGGGCCTCAGCTCGGCGCAGACCTCAATGGCGCCATGGACAGGGTCTGAC
ATGAAGTTGCTGATGAGGTCCTGGTTGACGGGCTCGTCCTTGTCCACCGTCACAAACGCCTGCTGGGTCAGGATGTAGTCGAAACGGGGCGCCCACTTCC
TCGACCCCAGCCGTGCCGTCGTCGAGCAGTTGTCCACCATGAAGGCCACCCCTCGCGCGTGCATGAACGGGTTCAGCGAGTCCACCGACTCGATCACGCT
CTCGTTGATGATCTCAGAGTAGGAGTGCCCCTTCTTCCTCAGCACCTCAATCTGGGCCATCATAAGTGCAACATAAACTCCAGCCGTGAAGGGGTGGAGA
GGGCCAAGGTCACCATCTGGCCGGGTCGAGCGCACCTTTTCGCCAACCTTCCACATCCGAGTTTGGTCGATTTTGCCCATAGGGAAAGCAGGAAGGCCTT
CCTTGTCATAGAACCTCCGACCAGCCAACACAACACTCCGGATTTCACTTCCAGAGGCAACATCTTCGTAGCATTCGTAGAGTATGTCCATGCAAGGGTA
AAATGATGCACTGTATGCCTTGTTGAACTCCTTTTTGCCTTCCTCGCTCAAGGAGTTGTATACTTCAAGCATCCCCTTCTTTGAGATGGTCTTGGAGATA
ATTCCAGTGATGCCCTCCACAGTGCTTTTGTATGCCAGCTCCTCGTCCATTCCTTGCTCTGTGTATCTCCTAAACAGAGCCTCCACGATGCCATGAACAG
CACCCAGCAAAATTCCTCGCTCCCCAAAGATATCACTCTTGTACTCCTGTTCTAGAGTGGTAGCAAAGGTGAACGGGGATCCTAGTGCAACCGACCACCC
AAGAGCAACATCAGTGGCCCTTCCATCAACATCCTGGTGAACAGCAAAGCTAGCGTTGATGCCAGCACCATTTACTTCCTTGCCCTGAACATACAGTCTC
CGAACTGATGGACCCATTCCCTTGGGGCATACAGCAACCACGCTGATGTTCTTAGGGAAATCAAGGCCATGTGATTGCAGATGTCCAAGGAGAAACCCGT
GAGATAAACCAAGAATGCTGTTTGGTTTCATGTGAGAGAAGATCTTCTCATAGTTGTCTGCCTGGGCAGAATCTGAGATCAACAGCAGCACAAGATCACT
GCCAGAGACCGTCTCCCATATGTCTCCCAAGGTTCCGTTCTCCTCGGTGAATCCAGCACCACGTGCTTCCTCAAAAGACTTGGAACCTTTCCTGAGGCCA
ATCTTGACGACGATGTCAGACTTGGCTTCCACCAAGGAATCCCTCAGGTTCTGGGCCTGCGCCGGACCCTGGGAGCCCCATCCGATGACCCCGATCTGCT
TGACGCCCTTGAAGGCCTCCGGGAGCAGCGGGAAGAGGTTGCGCCCGCCCCTCACGATGTACTCCTCGTGGCCGGCGAGGGAGACCTTCTCCTTGTTGAA
GACGGCGGTGTCGAAGTCGAGCGACGG
page-top