Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25029  (registered. 2007)
Contig Information
Length 830 bp
Clones 55 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 18
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 11
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative lipid transfer protein [Triticum aestivum]
Score 308
Evalue 8.80056e-50
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25029
CCACTTAGCAAGTCCATCCATCTCATCATATACATATGAGCTCAGCACTACTACTATTGCTAGCTTGATCAAGATGGCCCGTGCTGCAGCTGCTCAACTC
GTGTTGTTCACCCTCGTGGCAGCAATGGTCCTCACAGCCACAGACGCTGCAATCTCCTGTGGCCAGGTGAGCTCTGCCTTGAGCCCCTGCATCTCCTATG
CACGCGGCAGCGGCTCCAGCCCACCTGCGGCCTGCTGCAGTGGTGTCAGGAGTCTGGCCGGCGCAGCGCGGAGCACCGCTGACAAGCAAGCGGCGTGCAA
GTGCATTAAGAGTGCTGCTGGTGGGCTCAACGCTGGAAAGGCCGCTGGCATCCCCTCCAAGTGCGGCGTCAGCATCCCCTACGCCATTAGCTCATCCGTG
GACTGCTCTAAGATTCGCTGATCAACCACTGGCCACCATGGTCGCCGCCTATAGTGCCATCCATCGACACTAACTATGTTCGGGTCACACACACACACAC
ACACACACACATATATATACGAATAAATGCTGTTCATGTGAGACAGAGAGGAGTATGTATGTCGAGCCAGTTCTGCATGGCCGGTCACACTATTGTATCG
ATGTTTGGTTGTTACTTCTCTCCCGTTGAGGAGATACATGAGGTTGTTGTACTTTGTACCATGTGCACTTCTGATTTATGGATCGTATATTCAGCAGTAC
TCGCATGCGTCGTTATTACACATGCATGGCTGGCAAAACATTAGATTCCTGTTTCTTGCTCCAACCAAAATGTAGGCATGCGTTGTTATTTACTATAATG
GGAACAATCACATTTCGCTTAAAAAAAAAA
page-top