Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25010  (registered. 2007)
Contig Information
Length 1545 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 13
Wh_DPA20 Seed DPA20 8
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1A [Triticum aestivum] >gi|119388731|gb|ABL74262.1| alcohol dehydrogenase ADH1A [Triticum turgidum subsp. dicoccon]
Score 1851
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25010
GTGAGTGAGAGATCAGTTCTCGATTTCNATTCCGGTTCCGCTCAGAGAATTCCCCAGGCGAGCGAGCGAGATGGCGACCGCCGGGAAGGTGATCAAGTGC
AAAGCCGCGGTGGCGTGGGAGGCGGGGAAGCCGCTGTCCATGGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCTCTTCA
CCTCCCTCTGCCACACCGACGTCTACTTCTGGGAGGCCAAGGGGCAGACTCCCATGTTCCCTCGGATCTTCGGTCATGAAGCTGGAGGCATAGTGGAGAG
TGTTGGAGAGGGTGTGACTGAGCTTGCCCCTGGTGACCATGTCCTCCCTGTGTTCACTGGGGAGTGTAAGGAATGCCCACATTGCAAGTCTGCAGAGAGC
AACATGTGTGATCTGCTCAGGATCAACACCGACAGAGGTGTCATGATCGGGGATGGCAAGTCACGCTTCTCTATTGACGGGAAGCCGATTTACCATTTCG
TAGGGACTTCCACCTTCAGTGAGTATACTGTCATGCATGTTGGTTGTGTTGCCAAGATCAACCCTGAGGCTCCCCTTGACAAAGTCTGCGTTCTTAGCTG
TGGTATTTCCACTGGTCTTGGCGCATCCATTAATGTTGCAAAACCACCAAAGGGTTCGACAGTGGCGATATTTGGGCTAGGAGCTGTTGGCCTTGCTGCT
GCAGAAGGTGCAAGGATTGCAGGTGCATCAAGGATCATTGGTGTTGACTTGAACGCCAGCAGATTTGAAGAAGCTAGAAAATTTGGCTGCACGGAATTTG
TGAACCCGAAAGATCACACCAAGCCAGTTCAACAGGTGCTCGCTGAGATGACAAATGGTGGAGTTGACCGCAGTGTTGAGTGCACGGGCAACGTCAATGC
TATGATACAAGCATTTGAATGTGTTCATGATGGCTGGGGTGTTGCTGTGCTGGTGGGTGTGCCGCACAAGGACGCCGAATTCAAGACCCACCCGATGAAC
TTCCTGAACGAGAGGACTCTCAAGGGCACCTTCTTCGGAAACTTCAAGCCGCGCACTGACCTGCCCAATGTCGTGGAGATGTACATGAGAAAGGAGCTGG
AGGTGGAGAAGTTCATCACACACAGCGTGCCGTTCTCGGAGATCAACAAGGCGTTCGACCTCATGGCGAAGGGCGAGGGCATCCGCTGCATCATCCGCAT
GGAGAACTAGGCCGCCTAACGCGCTTCCGATCGCTCCGATGTAATAAGCGCTGGGGTGCGGTTTCTGAACCAGATCATCGTCTGTGGTTTCGCCTTCCTT
GGCAAAGTAGCGGAGTGTTAGTTCAAGTATATCTGTAATTACGTACCGGACAAGTGGCTGTACTACGAACGAGCTCTCTTTTGGCAGCAATATATGCTGC
TGCTGCTACTACTATGGCCATGAGTTTCAGTTGAATGAGTCTGTTCTTAGCCTATCTGATGTTTCAATGTCCCGTTGCTTTACTTTTCAGTTTTTCCTTT
ACTGCTCTGCTTGGCTGACTCTGCTGGGACCGTGCTTATGCTAAT
page-top