Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25007  (registered. 2007)
Contig Information
Length 1162 bp
Clones 53 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 7
Wh_EM Dormant seed with water absorption 7
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 5
Wh_RDr Root of dessiccated seed 10
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit nucleoside diphosphate kinase [Lolium perenne]
Score 750
Evalue 1.95058e-77
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25007
TTAATCAAAGCACGGCAAAAACATGAAATGCAACTCAATACCATATATCAAATATAGAGCAGCAGATAACGCTTGCATGCTCAAGCACAAGGAGATAACT
TCAGTTCACACAAACAAGGTTCCCAAGATACAAATCTCAAAACTGTAAACAACCAAAGACTAGTTTGGTAGATGCTTAATGAAACCTGCACTCAAACCAC
TCATGACACATCTTAGGCCTCATAGATCCAGTTGTGCTGGCTGCTCCTCCACTCTGCAATGCCCTCAGGGAACCACAGGGCGATCTCCTTCCTGGCACTC
TCAACTGAGTCGCTTCCATGGATGACGTTCCTGCCGATGTCGACGGCAAAGTCACCACGGATGGTGCCGGGCTCAGAGGCCAGGGGGTTGGTGGCGCCAA
TGATCTTGCGTCCAGTGGCGACGACGCTCTTGCCCTCCCAGACCATAGCGACGACCGGGCCGGAGACGATGTACTCCACGAGCCCAGCGAAGAAGGGCTT
GGAGGACAGATCGGAGTAGTGCTGCTCGGCGAACGACTTCTCCACGTTCTGGAGCTTCAGACCTTTGAGGTAGAAGCCCTTCTTCTCGAAGCGGCTGATG
ACCTCGCCGATGAGGCCCCTCTGGACGCCGTCAGGCTTGATCATGATGAAGGTCTGCTCGGCCATTGTTGCTGTGCTGAGCTTGAGATTTCTGATTGGGT
TTTGACCCTCGTGCCGACCGACGACAAGAGAGTTTACGAGGTGCCGGCGATCAAGGTGGCAGCTCTCAGGTTCACTGAGACGGCAAGGGCCCGCATTGTG
AATGCCGGTGGAGAATGCCTCACCTTTGACCAGCTGGCCCTTCGTGCTCCTCTTGGCCAGAACACGGTTCTCCTGAGGGGTCCAAAGAATGCCCGTGAGG
CAGTGAGGCACTTCGGTAAGGCTCCTGGTGTGCCGCACAGCCATACCAAGCCTTATGTCCGCTCGAAGGGAAGGAAGTTTGAGAAGGCAAGAGGAAGGAG
GAACAGCAGAGGCTTCAAGGTCTAGGTTCTTGCTTGGTGTTCATGTGCTACACAGCTCTTGTTTGAGTCTGAGTTATGTTATTATTAAGTGCTAGGATCA
TCTAAATTTTGTTCGAATGTCACGCATCTGTGCTGTGTATCCGTTTACCGGAAACTGTATGT
page-top