Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12015  (registered. 2012)
Contig Information
Length 1085 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 7
Wh_OKCS Seed DPA5 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XF Seedling, infected with leaf rust 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456505|ref|NP_001051853.1|| Os03g0841700 [Oryza sativa (japonica cultivar-group)]
Score 479
Evalue 2.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12015
TTTTTTTTTTAATCACCACATAACCGCCCAGACGTTATAAGCTACGCACAGCGGTAGCAGCTGACAGGTTCACTTGAAAAGTGCACAAATAATTCACAGT
AGCAAGGGCGTCTTTCTTGTTTTCGGGTCGGGAATGCTAGAAACTAAGCGTTCGTTCCTCTCAAAAGTACTCTTCTTCCAATGTAGACAAGACTGGCGGC
AACCACAACATGCGTGACAGAGACGGTCTCATTTCTTGTTGTTGTTGTTCAACATCTTGAGCGACTGGAGCCCAAGCAGCAGGTCACCCGAGTCGAGGAA
CACCTTGTTGTTGGAGGCTGCGATGGTGTGGGCGATCTCCCTGGCGGCTTCAATCTGCCTGAGTGCCACGAAAGCAGGGTTGTTGGCAATGGCATTGCCA
ATCAGCTCTGCACTCTTTGCCTCTCCCTGTGCCCTGATAATTGCACTCTTCTTGTCTTGCTCAGCCTTCTCAACAATGAACTTGGCACGCTCAGCTTCCT
GAGCAGCAACCTGTTTGGCTTCAATGGCATGAGTGAACTCTTTACCAAAGCTGAGACTGGTAATGGACACATCATCCAGAGCGATGTTGAAGTTCTTTGC
CCTCTCTGTCAGAATCTTCCTGATCTCCCTGCTCACAGCCTCTCTCTGTGTGATTAGCTGACTGGCATTGTATTGGGCAACCACAGCTTTGAGTGTTTCA
TGAATGATTGAAGGCAACACTCTCTCATTGTAGTTCTCCCCCAGGGTCCTGTACATAGTTGGTAGTCTCTCTGGCATGGGTCGTGTAAGAACACGAAGAC
CAATTCTCACCATCTGGAGATCCCGGCTCCCGGAGGTGCTCTCGACGAGGTTGGGTCGCGCGCGGACGTCGTAGATGATGGGCCTCTCGAACCACGGGAT
GACGATGTGAGTCCCCTCGGGGTAGACCTTGTCCTTGATCCCCTCGAGGCGGTTGAAGACGATGGCCCGGTGGCCTCCCTCGACGTTGTAGAGGGTCTTG
TTGCCGAGGTAGAGCGCGGCGCCGCCGAGCAGCCCGAGCTTGACCAGCGCGCCCGCGCCCGCCGGCGCGCTCGGCATCCTGGCGC
page-top