Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24979  (registered. 2007)
Contig Information
Length 3514 bp
Clones 50 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 8
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 5
Wh_VWD Shoot grown with dessication 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07454 [Oryza sativa Indica Group]
Score 3725
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24979
TAACGGGTCTCAGGAGCAGAAGCAGCATCTCAAGTTGTAGCAACATAATAACAACATAATACTCGGTTAATAAACAAGTTTGGGGGTCACCCAACTGCTA
CTACCATGTATGTACAGACACACATACCAGTACTCTATACTACTACCAAGTTCAAGTTGAAGAATCTTAAGACAACACAAAGCGAGGACTGGAAACTCTT
CGTCGTCATCATCATCAGCGGCAGCTCCCTGCAGACAGACCCTGAGAGAGAGAGAGGGTGTCACGCCAGGGCGGCGGTCGATGGAGCCTGCCTCTGCTCC
AGCTCGGGTCACGCAGCTTCACACCAGTGCGGCTTCAGCCAGACACAATAGGGCCTGGTGATCCAGTCCGGCAGCCAGGTCCTGGTCGTCGACCCACGTG
CTGGATACCCCCACGCCATTCTCTTCTCTTGCAGCCCACGTGGCGCCACTCATGTTCCAAGGAGCCAGTGGCGGCAACATGCGCCCCGTGGCGCCACTCA
CATATGCAAGGGGGAACAGCATTGCCAAGAACAAAGAAACCGGGCAAGGGGGCAAGGGGGCAAGGCGGCGACTAGCACTGCCATTGACCTCTCAGCCCTC
GTGCCGAATTCGGCACGAGGGGGGTGAACCACTCCCAAATGTCTCTGAGCTTCTGAGGTTGGAGGAAGTTGCTAAGCAACAGGGTTTAGGCCGTTGGAGC
AAGGAACCTGGTGCTGCTGAAGATTCGATAAGAGATCTTCCACCATCAGCAATTGGCGAACTAAGTGGTTTTGATGCAAAGGGTTTTGCAGTTGCAAATA
AAGGCAAGAGTCTGGAAGCCATTGTCGAACAAGTTCGTGATGGCAGTACCATTCGTGTTTACTTGCTTCCAAGTTTCCAATTTGTCCAGATATATGTCGC
TGGAGTGCAGGCTCCGTCCATGGGGAGACGACCACCGAATCCTACTGTTGTTGCCGAACCAGAGGGCACTACTAACGGCACTACAAATGGTGACGATTCT
GGGGAAGCTCCTGCACCACTGACAACAGCACAAAGGCTTGCTGCATCGACAGCCTCTACTGAAGTTCCACCAGATAGGTTTGGAAGAGAAGCTAAGCATT
TCACAGAGACTCGTGTTCTGAACAGAGATGTGCGGATTGTGGTGGAGGGGACAGACAGTTTCAGTAATATAATTGGTTCGGTGTATTACCCAGATGGTGA
CACTGCTAAGGACTTGTCCCTTGAGCTTGTTGAAAATGGTCTTGCGAAATATGTGGAATGGAGTGCGAACATGCTAGATGTTGAAGTTAAAATAAAGCTG
AAGAATGCTGAACTTCAGGCAAAAAAGGAACAGCTGAGAATTTGGACTGGATTTAAGCCACCAGTGACAAATTCAAAGCCAATCCATGATCAGAAATTCA
CTGGAAAAGTGGTAGAAGTTGTGAGTGGTGATTGTATTATTGTTGCTGATGATGCTGCTCCTTATGGAAGTCCTTCAGCAGAACGGCGGGTTAATCTTTC
AAGTATTAGAGCTCCTAAGCTAGGCAATCCTCGCAGGGAGGACAACAAGCCCGACAAATTTGCTCGTGAATCTAAGGAATTCTTGCGCACACGGTTGATT
GGCAAACAGGTGACCGTGGAAATGGAATATTCTAGAAGGATCAGCACCATGGATGGACAGAATGCTGTGCCTGTAATGAACTCGGCTGATACCAGAGTTT
TGGATTATGGTTCAGTTTTTCTAGGTTCGCCATCACCGGCGGACGGAGATGACACATCTTCTGCTCCAAGCACAGGCACCCAGCCTAAAATTAATGTTGC
TGAGCTTTTGCTCTCACGGGGCTTCGCTGAGATATCAAAACACCGTGACTACGAGGAAAGATCACATTATTTTGATGCTCTATTAGCGGCTCACTCACGT
GCTGAGAAAGCAAAGAAAGGAATTCACTCTGACAAACTTCCTCCTGTGATGCATATAACCGATTTAACAATGGTTAATTCTAAGAAGGCCAAAGATTTCC
TTCCCTTCCTGCAGCGGAATAGAAGGCATACTGCTGTTGTTGAATATGTGTTCAGCGGTCATCGTTTCAAACTAACAATTCCGAAGGAGACTTGCAGCAT
CGCTTTTTCTTTGTCTGGTGTTAGGTGCCCTGGTAAAGATGAGCCCTACTCGAGCGAAGCTATTGCTTTGATGAGGAGGATGATTCTACAGCGTGATGTG
GAGATTGAGGTTGAAACAGTTGATAGAACTGGAACATTCATAGGTTCCTTGTGGGAGTCTAAGACCAATGTGGGTTCTGTTCTTTTGGAGTCTGGCTTGG
CCAAGCTTAGTTCATTTGGCTTGGATAGGATTCCAGATGCTCATGTCCTCACAAGAGCTGAAAAGTTAGCAAAGCAGCAGAAACTGAAGATATGGGAGAA
CTATGTCGAGGGTGAAGAAGTTACTAATGGGTCGGCCTCTGAATCCAAACAAAAGGAAATTCTGAAGGTTGTTGCTACTGAAGTTCTTGGTGGTGGAAAG
TTCTATGCCCAGACAGTAGGTGACCAGAGAGTAGCTTCCATCCAACAACAGCTTGCATCCTTGAAACTTAAGGAGGCACCAGTCATTGGTGCTTTTAATC
CTGGGAAGGGAGAGATAGTTCTTGCTCAGTTTAGCCTCGACAACTCTTGGAATAGAGCCATGATTGTTAATGGACCCCGAGGAGCTGTAGAGTCTGTAGA
TGACAAATTTGAAGTATTCTACATTGATTTTGGTAACCAAGAAGTGGTTCCTTACAACCGCATCCGGCCTGCAGACCCATCAGTATCCTCCTCTCCTCCT
CTTGCTCAGCTGTGCAGCCTTGCCTTCATCAAAGTGCCTGGTCTGGAAGATGATAATGGTCAGGAAGCAGCAGAGTATCTTAGTGAATGCTTGCTAAGCA
GTTCAAAACAATACCGGGCAATGATCGAAGAGCGCGACACTACTGGTGGAAAAGTGAAGGGACAAGGCACTGGACCTGTTCTCATTGTGACTCTTGTTGA
TCCAGAGACAGAATCCAGCATCAATGCTGCCATGCTCGAGGAAGGGCTTGCCCGACTTGAAAGGGGCAAGAGATGGGACACCAAGGAGAGGAAGACAGCT
CTCGAGAATCTGGAACAGTTCCAGGAGAAGGCGAAGAAGGAAAGGCTGCGGCTGTGGCAGTATGGAGACGTCGAATCTGACGAGGAAGATCAAGCTCCAG
GCGGGAGGAGACCCCCGCCGCGTCGGTAGACGAGATAATGCCGCGGCAGGCAGTGGCGCAGTCATGGTTTAGATATGAAAGTTTTGGACACCGAGCGGAA
CTCAGTCGAGAGCTTATATATGAAAACTAGTGAGAGAGAGAAGACTATATTTATGCAATTAGAAGAGAACTATATACATTGTTTTTCCCCTAAGCTCAAT
AAGGTCTGTGTCCTTTGTGGACTGCGTTTCTTCTTTGTAGAGACAGAACATATAATACTGAGGATTGCAGTCAAATGGAAATTAAATTCAGGTTTGATAC
TTTAATATACCAAA
page-top